308 мерс: Доступ ограничен: проблема с IP

  • 05.03.1980

Содержание

Отзыв Mercedes 308D (Мерседес Т1) 1994 г.

Здравствуйте! Давно хотел написать о ветеране труда, о модели которая выпускалась с 79 по 94 год, о mersedes benz 308D, индекс модели T1. Ее полная масса 3,5т, грузоподъемность паспортная 1,3т, права нужны категории В, т.е. легковые.

Эти машины до сих пор в Беларуси безумно популярны, хоть уже и существенно разбавлены более новыми немцами, французами и итальянцами. Коммерческих авто азиатских стран у нас мало, только если лизинговые грузовики полной массой от 5т.

До момента покупки я работал на офисе, продавал лицензионный софт через свою конторку. Работа меня не очень устраивала, я не мог ей отдаться полностью, изучать все эти антивирусы, виндовсы, серверные продукты сутками, мне было не интересно, и не могу я сутками сидеть за компом.

Позвонил я другу, он был связан со стройкой, сказал, что хочу поменять деятельность. Мне очень повезло, он сказал надо купить грузовичок и есть место, где будем работать.

Надо была машинка которая выдерживала бы рейсы по 500-900 км в день, 5 дней в неделю.

Должен быть холодильник, категория В. Бюджет на то время был до 7000$ (250 000р). Выбор был не долгим, за такую цену на ходу была у нас только одна машина, остальные уже раза в 2-3 дороже.

Поэтому не обладая должным опытом в оценке авто, и не обладая большими деньгами для хоть какого-то выбора я ее взял за 6400 при первоначальной цене 7000$. При просмотре сразу видно было, что она крашена-перекрашена, но заводилась с полтычки, почти не коптила и холодильник работал. Дно с рамой было ржавое, но оценить его прочность и живучесть я не мог.

Поставил я ее на маршрут, сам с другом сел за руль. То время было благодатное для таких работ, за месяц можно было прибыли заработать 2500$ на машину. Правда работать приходилось работать сутками, подъем в 1-2 ночи, через час самим в ручную надо было ее загрузить, развести, выгрузить клиентам персчитав эти шоколадки, мармеладки, баночки с детским питанием и кофеёчки и вернуться домой. Хорошо если к 18-19 ты уже дома. Но молодые силы не покидали, в планах быстрее собрать другу на машину.

А теперь о самом мерседесе, из-за цвета, и состояния кузова я его называю дракончиком.

И так я имею цельнометаллический фургон 94 года, с простым дизелем 2,3л под 80 лошадок.

Мой рост 185, вес под 75 кг.

Машина хоть и спроектирована в 70-х годах, проста до безобразия, но удобна по трассе до 90-95км/ч, невероятно удобна при езде по городу.

Чтобы комфортно ехать по трассе поставил скоростной мост(400$) (не просто так захотелось, а старый засопливил и почти сдох)от модели полной массой 2,8т. У нового на 13% «длинне» передача, на четвертой разгонял до 95, а есть еще и пятая. Но максималка где то 100-105. Заменил глушитель и стало раза в 2-3 тише. Поставил бу фары, оригинал и почти идеал за… 20$ (700р) каждая, противотуманки купил в магазине для фур и могу, если отдухнул, за раз (без передышки) проехать километров 300, при средней скорости 85.

Мне очень удобен большой руль почти «по- автобусному» и старое рваное водительское кресло. На многих легковых устаешь куда быстрее. И еще чем хуже погода, тем лучше себя в ней чувствуешь, поток машин в дождь или снег существенно замедляется, а тебе хоть бы хны. Но если снега выпало сантиметра 4,то машина уже просто не тянет с обычной скоростью. Говорить о том, что выше сидишь и поэтому дальше видишь я не буду, это понятно. Расход топлива летом от 8л при 75 км/ч до 12 при 100км/ч. Город не измерял, но Минск по ощущениям от 10(ночь) до 15(день) литров.

По городу ездить просто прелесть, отличный обзор, хорошие зеркала, отличное чувство габаритов, большой дорожный просвет из-за которого машина совсем не боится бордюров (часто надо подъезжать к магазинчикам по тротуарам и т.д.) и ооооочень большой угол выворота передних колес, близкий 90 градусам. Но в городе должна быть хорошо настроена коробка передач (а именно капризная кулиса которая стоила мне 300$), иначе это может все быть адом. Дракончик может трогаться даже с третьей, но о комфорте речи здесь не будет. Минусом в городе конечно является и слабый мотор, но обзорность и мастерство приводят к тому, что выбираешь правильно среднюю скорость для проезда светофора на зеленый, заранее перестраиваешься и не тормозишь на препятствиях и едешь даже быстрее чем процентов 70 потока.

Эксплуатация.

На одометре при покупке замерла цифра 445 тыс. км. Сколько лет он до меня не работал это загадка. Я его так и не починил. Менял тросики спидометра два раза и их все время скручивало. Я бросил эту затею и определяю скорость по навигатору.

За 2,5 года я на ней проехал тысяч за 250. Всем говорю, что заменил почти все, что ниже сидений в первые полтора года. Когда спрашивают: «А эти немцы надежные?», я отвечаю: «Ремонтопригодные!».

Когда меня спрашивали как я на ней приехал из Минска за 300км, не развалится ли она по дороге, отвечал, что могу спокойно поехать в Крым, что там 2 тыс. туда и обратно. Я реально на ней проезжал это за 6 рабочих дней.

Первый вопрос после покупки у меня к дракончику, выдержит ли нагрузку хотя бы на пол года? Выдержал, но с трудом. Первое что сдалось аккумулятор, второе, масла был расход 0,7 л на 1000 км. Третье, тормоза задние отсутствовали напрочь. Четвертое, стала рессора поднимать в кузове пол. Пятое, рвало обшивку по бокам кузова, и кузов как-бы расширялся. Все кроме жора масла устранил.

На шестом месяце эксплуатации, в январе, сдал на полную переварку днища пацану из гаража. Пол снова поднялся почти весь, машина стала просто рваться на куски. Никто браться за такую машину не хотел, или предлагали ждать тепла, а я не мог ждать. Другу уже выбирали машину. Сдавать дракончика на металлолом я не мог, купить другую тоже, деньги я отдолжил, на чем то работать надо было.

В машине выкинули весь старый пол, как-то усилили раму, постелили новый пол из толстого листа 2мм. Радовался я не очень долго, пацан был самоучка, ничего не шарил ни в нагрузках, ни в жеткости, ни в профилях. Он считал что ровный пол!!! выдержит основную нагрузку и поэтому раму под полом приваривал больше для красоты, чередуюя старые ржавые куски прогнившего металла и новые профиля. Сдавая мне машину довольный сказал, что дает гарантию то ли год то ли два. Машина начала через три месяца опять рваться. Я к нему приехал, он вылупил глаза, спросил сколько на нее гружу, но сделал.

Приехал еще через пару месяцев, я ему уже показывал какие профиля и куда вставлять, он делал. Даже в первый раз «гарантийного» ремонта понял, что он некачественно делал просто потому, что не шарил в этом ремесле. У него хорошо получалось приварить к легковым новые пороги, арки и даже «задницы», но не такие машины.

И я понял, что такая проблема не только с этим пацаном. Я нашел еще одного молодого сварщика, одного старого которые к сожалению тоже варили легковые. Блин, они смотрели под машину, говорили что там все крепко, усиливали мне какую ни будь стойку на месяца два. И все.

Заехал я к другу в цех, который делает оборудование для нефтянки, увидел какие должны быть сварные швы, какие жесткие конструкции и решил: Пошли они все эти кулибины лесом, буду ездить пока безопасно, а потом куплю сварочный аппарат и с батей все переварю сам.

Через год после суперпереварки так и сделали. Разобрали пол, выкину старую раму, положили через весь кузов два мощных профиля, почти как рельсы, поперечины, зашили пол, по ощущениям жесткость стала достаточная для перевозки 3 тонн, при паспортных 1,3. Но я никогда больше тонны не возил. Наконец вопрос этот решен за полтора года ничего не повело, не провисло, не прогнило. Только конечно внешние элементы и двери очень ржавеют, их уже и переваривали, и перекрашивали, но время берет свое.

Через год после покупки продал двигатель на з.ч. 500$ и взял в сборе за 1500, т.к. прежний уже ел масло в размере 1л масла к 10 литрам солярки. Т.е. Масло я подливал чаще чем заправлялся, у нас в Беларуси есть завод Нафтан, он выпускает базовые масла(что делают очень мало компаний в мире) и есть там масла для самых простых турбодизелей класса евро 2 (4л-350 руб). Дракончик просто ел это масло не чадил, не дымил, идеально заводился. И сказать, что тут такой бешеный расход масла никто не мог, визуально столько масла не горело, если сравнить выхлоп мотоцикла ИЖ в идеальном, состоянии, то у меня выхлоп был похожим, только что объем двигателя 2,3л.

Заменили мне двигатель на новый, по ощущениям у него остаточный ресурс 1/3 не более, заводился хуже, подтраивал, масла хватало точь в точь от замены до замены(это минус 1,5л на 10т. км.). Я сразу же его отдал на замену верхней прокладки, притирку клапанов, замену маслосьемных колпачков(300$). Троить перестал, расход масла не изменился, тяга стала лучше.

Так и езжу на нем последние 1,5 года, т.е. где то 150 тыс. км. Пока держится.

Ну а последний год вроде бы ничего серьезного не было. Ремонтировал холодильник 300$, коробку(менял кулису) 300$, ну и расходники всякие, тросики, тормозные цилиндрики, колодки.

Осталось мне определенную сумму на квартиру насобирать и гори оно красным пламенем, точнее едь все на разборку или на металлолом. А может кому дракончик и нужен будет такой какой он есть. Он сейчас явно лучше, чем я его брал, явно дешевле. Не каждый аппарат в возрасте выдержит по 700 км ежедневно. Я просто сам уже не выдерживаю… больше отдыхаю, меньше дней работаю, хочу на нормальную работу с 8-ми часовым рабочим днем, ну пусть с 10-ти часовым…. Ведь у меня есть жена и два сыночка, пол годика и два.

БУшные ПЯТИЛЕТКИ: Mers A-class, Peugeot 308, Toyota Prius

Какие вопросы возникают при покупке подержанных авто?

Мерседес А-класса второго поколения появился на дорогах в 2004 году, а в 2008-ом пережил плановый рестайлинг. Этот хэтчбек предлагается в нескольких модификациях, как с бензиновыми моторами, так и с дизельными, которых, к слову, стоит остерегаться. По отзывам владельцев, на моделях А-класса двигатели на тяжелом топливе капризны к некачественному топливу, поэтому зачастую приходится менять форсунки и ТНВД.

Многие автомобилисты, когда слышат про французские автомобили, думают, лучше с ними не связываться. И действительно, при выборе француза стоит быть особенно бдительным. Как известно, это деликатная техника, требующая особо ухода. Пежо 308 в данном кузове выпускался с 2007 по 2011 год. За это время выявились основные недостатки. Первый и самый главный — дизельные двигатели. Если Мерседес А-класса капризный, то Пежо 308 изысканный и требует сверхкачественное топливо.

Тойота Приус с латинского переводится как «идущий впереди». По сравнению с конкурентами это действительно так. Гибридная установка, самый малый коэффициент сопротивления и рекуперативное торможение. В этой модели японцы представили технологий больше, чем в моделях конкурентов, вместе взятых. Начало выпуска Приуса было налажено в 1997 году, а второе поколение появилось в 2003-ем. В белорусских климатических условиях автомобиль ведет себя адекватно. Лишь в большие морозы владельцы жалуются на аккумуляторные батареи. В остальном Приус надежен. По отзывам подвеска может выдержать огромнейшую нагрузку в 150 тыс. км пробега, а стоимость ТО и запасных частей не выше других автомобилей этого класса.

В любом случае при покупке хэтчбека следует учесть, что помимо характерных недостатков, могут появиться и другие, ведь история эксплуатации автомобилей, бывших в употреблении, в большинстве случаев неизвестна. Необходим тщательный осмотр всех основных узлов и агрегатов, а также кузовных элементов на специализированном сервисе. Лишь после прохождения всех подобных процедур мы советуем покупать автомобиль. Удачи в вашем выборе.

Евгений Резанович

Тест-пилот «Автопанорамы»

Благодаримза помощь в подготовке материала Центр по продаже автомобилей «4 колеса» (ул. Тимирязева, 119)
http://www.4kolesa.by/

ОСАГО на Mercedes-Benz 308 | Оформить ОСАГО Онлайн на Mercedes-Benz (Мерседес) 308

Спасибо!!!!!

Обратился за дистанционным переоформлением полиса ТТТ 7014279610. Сотрудник быстро взяла в работы и все подготовилаСпасибо, как всегда на высшем уровне!… Читать

Илья, Нефтеюганск

Выплату произвели быстро. Не со всем понятно как производится расчёт.

После ДТП, где на меня при повороте направо, наехал Мерс. Тогда еще действовал полис ВСК серия РРР No ****. Очень быстро насчитали сумму убытка. За поврежденный… Читать

Ольга, Уфа

Сбербанк страхование. Купил полис ОСАГО

,цена ниже ,чем остальные предложения, примерно на 1000р.; доволен , надеюсь, что обращаться за выплатами не придётся 🙂 Читать

Садовников Антон Владимирович, Тольятти

Рекомендую

Быстро оформили страховку тариф самый низкий среди страховых компаний, оформляю и страховку ипотеки и осаго Читать

Василенко Наталья Александровна, Архангельск

электронный полис

Второй год подряд заказываю электронный полис ОСАГО. Это очень удобно как по времени так и по цене!!! В этом году сразу, после покупки, не распечатала… Читать

ГРУЗИНЦЕВА ГАЛИНА ВАСИЛЬЕВНА, Калуга

Полис ОСАГО Сбербанк страхование

Очень порадовала цена полиса ОСАГО. По страховому случаю не обращалась. Очень надеюсь что и не понадобится. 🙏 Читать

Русина Юлия Викторовна, Тверь

Рекомендую!!!

Обратились за вниманием в полис ОСАГО ХХХ ****. Все сделали быстро!  Приятные, грамотные сотрудники.Всем рекомендую Читать

виктория, Нефтеюганск

Лучшая страховая компания!

Страхуюсь не первый раз отличная компания! Пилис XXX-****. Приветливые сотрудники помогут расскажут. Очень понравилась доп услуга ремонт у дилера. Желаю… Читать

Дмитрий, Москва

По чему то не пришел полис.

Пришлите полис! Одной смс с номер мне мало, да и сотрудникам ГИББД этого тоже маловато. У нас в Армавире только офис на Лермонтова, и там обычно толпа… Читать

Аноним, Краснодар

Уроки SARS и MERS

Eur J Immunol. 2020 март; 50(3): 308–311.

, 1 , 1 и 1

Парк Мирэ

1 Национальный институт сердца и легких, Имперский колледж Лондона, Лондон, Великобритания,

Райан С. Туэйтс

1 Национальный институт сердца и легких, Имперский колледж Лондона, Лондон, Великобритания,

Питер Дж.

М. Опеншоу

1 Национальный институт сердца и легких, Имперский колледж Лондона, Лондон, Великобритания,

1 Национальный институт сердца и легких, Имперский колледж Лондона, Лондон, Великобритания,

Автор, ответственный за переписку.Copyright © 2020 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Эта статья находится в свободном доступе через PubMed Central в рамках мер реагирования на чрезвычайную ситуацию в области общественного здравоохранения COVID-19. Его можно использовать для неограниченного повторного использования и анализа в исследованиях в любой форме и любыми средствами с указанием первоисточника на время чрезвычайной ситуации в области общественного здравоохранения.

Введение

В декабре 2019 года в Ухане, провинция Хубэй, Китай, стало появляться новое легочное заболевание.Он казался очень заразным и устойчивым к терапии, что вызывало серьезное беспокойство у врачей. В течение месяца в одну больницу был госпитализирован 41 пациент, один из которых скончался. Первые случаи были тесно связаны с рынком морепродуктов Хуанань, на котором экзотические животные продавались в пищу. Рынок был закрыт, но прошло несколько недель, прежде чем чиновники здравоохранения смогли ввести строгие меры карантина в этом районе.

Передача и эпидемиология

В течение нескольких недель после первых случаев была выпущена серия документов с подробным описанием эпидемиологии заболевания (теперь называемого COVID-19) [1, 2, 3].К началу января 2020 года вирус был идентифицирован и определена его последовательность. Вирус (обозначенный как SARS-CoV-2) имеет 88% идентичность последовательности с двумя коронавирусами, обнаруженными у летучих мышей, bat-SLCoVZC45 и bat-SL-CoVZXC21, 79% идентичность с коронавирусом тяжелого острого респираторного синдрома (SARS) и 50% идентичность с коронавирусом. Коронавирус ближневосточного респираторного синдрома (MERS) [4]. Из первой группы пациентов 8 полных геномов были идентичны по последовательности на 99,9%. Учитывая, что типичный РНК-коронавирус развивается со скоростью 10 4 нуклеотидных замен в год, это предполагает недавнее появление единственного источника в начале декабря или конце ноября 2019 г. [4].Считается, что SARS-CoV-2 передается через загрязненные руки, поверхности и аэрозольные капли; очевидна широкая передача от человека к человеку с скоплениями инфицированных семей и медицинского персонала [5]. Число подтвержденных случаев быстро росло, темпы, которые намного превышали темпы роста случаев атипичной пневмонии в 2002–2003 гг., что вызывает серьезную озабоченность в области здравоохранения во всем мире. К 21 9004 января случаи заболевания COVID-19 были широко распространены на материковом Китае, вскоре распространившись за пределы Китая.

30 января 2020 года Комитет Всемирной организации здравоохранения (ВОЗ) по международным медико-санитарным правилам объявил чрезвычайную ситуацию в области общественного здравоохранения, имеющую международное значение. По состоянию на 24 февраля 2020 г. во всем мире было зарегистрировано 79 331 лабораторно подтвержденный случай и 2618 случаев смерти [6]. Большинство из них в Китае с 77 262 случаями и 2 595 смертельными исходами [6]. Очевидно, что многие все еще страдают от COVID-19 и могут выздороветь, а могут и не выздороветь. Это лишь небольшая часть от общей численности населения Китая (1428 миллионов человек), и продолжаются напряженные усилия по ограничению распространения.Однако в настоящее время SARS-CoV-2 распространился на 29 стран, причем Республика Корея занимает 2  и 90 005 место по количеству случаев заболевания (893 случая с 8 смертельными исходами) [6]. В Великобритании зарегистрировано 13 подтвержденных случаев, 8 из которых выздоровели и выписаны домой. По состоянию на 25 февраля 2020 года в 7 странах ЕС/ЕЭЗ было выявлено 276 случаев заболевания и 7 смертей. Большинство этих случаев было связано с всплеском местных случаев заболевания в Италии, в результате чего погибло 6 человек. В Иране также недавно наблюдался рост заболеваемости: 61 случай и 12 смертей [7, 8].

Согласно первому 41 зарегистрированному случаю, смертность оценивалась на уровне 15%. Общий уровень смертности в настоящее время неизвестен, но может достигать 1–2% всех инфекций; однако ожидается, что по мере того, как выявляется больше случаев с легким или незаметным заболеванием, этот показатель будет снижаться. Средний инкубационный период составляет около 5 дней, но он также весьма вариабелен и может достигать двух недель [3]. Около 60 000 активных случаев ожидают окончательного результата, поэтому в настоящее время трудно определить смертность среди пациентов с COVID-19.Один случай в Египте — это первый случай, выявленный в Африке, в то время как во многих развивающихся странах с низким уровнем ресурсов случаев заболевания не было. Этот очевидно низкий уровень передачи в такие страны может быть следствием мер общественного здравоохранения, принятых для ограничения распространения SARS-CoV-2 в Китае, или может отражать ограниченные диагностические возможности в условиях ограниченных ресурсов.

SARS-CoV-2, по-видимому, предрасположен к пожилому мужскому населению и пациентам с сопутствующими заболеваниями. Наиболее распространенные симптомы включают лихорадку (83%), кашель (82%) и одышку (31%) [1, 2].У большинства (75%) пациентов на КТ были двусторонние пневмонические изменения [2]. В недавнем обновлении Китайского центра по контролю за заболеваниями 81% инфекций считались легкими и только 1,2% бессимптомными [9]. В первом отчете с подробным описанием инфекции у детей было обнаружено только 9 случаев COVID-19 у детей; 7 из них были женского пола, и ни одному из них не потребовалась интенсивная терапия, что потенциально указывает на то, что дети могут быть менее восприимчивы к инфекции и/или симптоматическому заболеванию [10].

Сравнение с другими инфекциями нижних дыхательных путей

Инфекции нижних дыхательных путей являются наиболее смертельными инфекционными заболеваниями во всем мире, вызывая 3 миллиона смертей в год и занимая 4   самых частых причин смерти во всем мире, включая эндемические, эпидемические и пандемические вирусы.В 2009 г. пандемия гриппа (h2N1) распространилась на 214 стран и привела примерно к 500 000 смертей при коэффициенте летальности около 0,2% [11].

Существует множество других коронавирусов, патогенных для человека, но проявляющихся легкими клиническими симптомами. Тем не менее, SARS-CoV-2 является 3 из высокопатогенных коронавирусов, появившихся за последние 2 десятилетия. Первой вспышкой был SARS в 2002 году в китайской провинции Гуандун на «мокрых рынках» (например, на рынке Хуанань, где, как считается, впервые появился SARS-Cov-2).Всего было зарегистрировано 8 422 случая атипичной пневмонии с 916 летальными исходами в 29 странах. Расчетная летальность от атипичной пневмонии составила 11% [12]. Коронавирус ближневосточного респираторного синдрома (MERS) стал причиной вспышки тяжелого респираторного заболевания в 2012 году на Ближнем Востоке. Было подтверждено 2494 случая заболевания, 858 человек погибли; В Южной Корее было зарегистрировано 38 смертей, в общей сложности 27 стран сообщили о случаях БВРС (таблица) [13].

Таблица 1

Сравнение количества случаев и смертей после времени первого обнаружения, относительно MERS, SARS

[13] 9
Местоположение происхождения Местоположение происхождения Случаи Смерти * Страны с подтвержденными случаями ссылки
SARS GUANGDONG, China 2002-2003 8 422 916 11% 2-4 29 12]. 4% 1 27 [13]
Covid-19 Wuhan, China 2019 — настоящее время # 79,331 79,331 2 618 ~ 1-2% 2.2 29
Ph2n1 Throngenza North America 2009 500 000 ** 0,2% ** 214 [11]

Это Статья находится в свободном доступе через PubMed Central в рамках мер реагирования на чрезвычайную ситуацию в области общественного здравоохранения COVID-19. Его можно использовать для неограниченного повторного использования и анализа в исследованиях в любой форме и любыми средствами с указанием первоисточника на время чрезвычайной ситуации в области общественного здравоохранения.

Считается, что коронавирусы SARS и MERS, как и SARS-CoV-2, произошли от летучих мышей и передаются человеку от промежуточного хозяина, циветт и верблюдов-верблюдов соответственно. Для SARS-CoV-2 зоонозный источник и промежуточный хозяин еще предстоит подтвердить, но благодаря недавним достижениям в секвенировании всего генома можно быстро провести подробный филогенетический анализ и использовать его для установления подробных эволюционных связей.

Улучшенная способность идентифицировать и диагностировать новые патогены позволила быстро принять глобальные меры для минимизации воздействия и координировать международные ресурсы; однако влияние, которое это окажет на глобальное воздействие COVID-19, остается неизвестным. Одной из первых мер, принятых местными властями, было оповещение ВОЗ в течение 4 недель с момента выявления первого пациента. Это резко контрастирует со вспышкой атипичной пневмонии, когда она длилась 4 месяца. За идентификацией нового коронавируса во время вспышки SARS-CoV-2 вскоре последовало закрытие рынка Хуанань с целью предотвращения дальнейшей зоонозной передачи.Во время вспышки атипичной пневмонии выявление циветт как резервуара болезни было отложено, и циветты продолжали продаваться на продовольственных рынках. Такие шаги, как закрытие рынка, способствовали выявлению и сокращению передачи от потенциальных животных источников, и ВОЗ рекомендовала соблюдать осторожность, чтобы избежать незащищенных контактов с сельскохозяйственными или дикими животными [6].

Перспективы и ведение случаев

На данный момент количество зарегистрированных случаев COVID-19 продолжает расти, но более медленно.Однако при таком широком распространении как в Китае, так и за его пределами вполне вероятно, что последующие вспышки будут продолжаться. Важно отметить, что в наших знаниях об эпидемиологии заболевания, основных предрасполагающих рисках, скорости передачи, клинических проявлениях и фенотипах, а также о вариантах лечения существуют существенные пробелы. Тем не менее, мы многое узнали из вспышек SARS и MERS, которые повлияли на местные и глобальные ответные меры на текущую вспышку. Наша способность быстро идентифицировать новые патогены с использованием секвенирования всего генома и разрабатывать диагностические тесты на основе ПЦР на основе этих данных ускорила нашу способность выявлять случаи и понимать эпидемиологию заболевания на гораздо более ранних этапах эпидемии.Это повлияло на текущую стратегию снижения передачи вируса от человека к человеку, особенно медицинским работникам.

Еще одной ключевой стратегией снижения передачи инфекции является правильная сортировка и выявление пациентов с тяжелыми острыми респираторными инфекциями при первом контакте, чтобы свести к минимуму контакт с другими людьми. Эпидемиологические и клинические критерии должны быть соблюдены, чтобы быть классифицированным как возможный случай. В настоящее время любой человек с тяжелой респираторной инфекцией, требующий госпитализации, без альтернативного диагноза и истории поездок в пострадавшую страну в течение 14 дней до появления симптомов, или любой человек с любым острым респираторным заболеванием и контакт с подтвержденным или вероятным случаем COVID-19. (в том числе в медицинском учреждении) подпадает под определение подозрительного случая [14].Эти определения случаев немного различаются в разных странах, и Служба общественного здравоохранения Англии (PHE) включает клинические или радиологические признаки пневмонии, специфические симптомы одышки или кашля, или любого человека с лихорадкой, который в анамнезе путешествовал в перечисленные страны [15].

Населению следует соблюдать общие меры предосторожности, чтобы избежать контакта с пациентами, страдающими острыми респираторными инфекциями. В медицинских учреждениях следует соблюдать меры предосторожности, такие как надлежащая гигиена рук и использование средств индивидуальной защиты (СИЗ), чтобы избежать прямого контакта с выделениями или жидкостями организма пациента.Образцы следует проверять на обычные бактериальные и вирусные инфекции, а также использовать образцы верхних и нижних дыхательных путей для тестирования на SARS-CoV-2. Это должно быть выполнено с использованием полимеразной цепной реакции в реальном времени (RT-PCR). Серологические тесты находятся в разработке, но их следует использовать только в том случае, если ОТ-ПЦР недоступна [16]. Ключевой частью инфекционного контроля является детальное отслеживание контактов.

Следует принимать ранние поддерживающие меры, включая поддерживающую оксигенотерапию при дыхательной недостаточности и гипоксии, более инвазивную респираторную поддержку, если требуется, внутривенные жидкости, противомикробные и противовирусные препараты.Текущие опубликованные данные указывают на длительный умеренный инкубационный период с последующим быстрым прогрессированием заболевания: 8 дней — среднее время от первых симптомов до появления одышки, 9 дней до острого респираторного дистресс-синдрома (ОРДС) и 10,5 дней до госпитализации в реанимацию. [1]. В одном исследовании из 99 случаев у 17% развился ОРДС, 13% потребовалась неинвазивная респираторная поддержка, 4% — инвазивная вентиляция легких и 3% — экстракорпоральная мембранная оксигенация (ЭКМО) [2]. Такие инструменты, как шкала MuLBSTA, которая включает факторы риска и сопутствующие заболевания, такие как курение, артериальная гипертензия, возраст, сопутствующие бактериальные инфекции, лимфопения и пораженные участки легких, могут быть полезны для прогнозирования смертности у пациентов с вирусной пневмонией [2, 17]. .

Терапевтические перспективы

Эпидемии SARS и MERS, а также наше лечение других эндемичных и эпидемических респираторных вирусов могут дать некоторые рекомендации по стратегиям лечения, которые могут принести пользу пациентам с COVID-19. В настоящее время не существует специфической терапии против COVID-19, но было начато более 80 клинических испытаний для борьбы с COVID-19 [18]. Эти испытания включают комбинацию лопинавира и ритонавира против ВИЧ (ингибиторы протеазы, которые, как сообщается, снижают репликацию SARS и MERS), а также ремдесивир (утвержденный ингибитор обратной транскриптазы, который аналогичным образом продемонстрировал активность in vitro против SARS-CoV-2). [19]).Также возможно усилить защитный иммунный ответ хозяина на инфекцию или ингибировать иммунопатогенез (который, как считается, способствует тяжести заболевания для некоторых респираторных патогенов). В частности, считается, что «цитокиновые бури» вносят основной вклад в тяжесть многих инфекций нижних дыхательных путей, таких как грипп [20] и атипичная пневмония [21]. Таким образом, направленная на хозяина терапия может быть направлена ​​либо на усиление врожденного иммунного клиренса SARS-CoV-2, либо на подавление воспалительного повреждения дыхательных путей и развитие вторичных бактериальных пневмоний.В первом 41 случае 22% получали системные кортикостероиды с целью подавления вызванного воспалением повреждения легких [1]; однако текущие рекомендации ВОЗ не рекомендуют их использование, а данные SARS и MERS показали, что кортикостероиды не снижают смертность и потенциально замедляют элиминацию вируса [22, 23, 24]. Исследуемые альтернативные стратегии включают иммуномодуляцию хлорохином (который также может иметь противовирусную функцию [19]), моноклональными антителами и иммуноглобулинами.Эти интервенционные исследования, в дополнение к обсервационным исследованиям, улучшат наше понимание тяжелых инфекций COVID-19, в частности, относительного вклада вирусной нагрузки и последовательности (хотя текущие данные указывают на небольшое разнообразие штаммов среди случаев до сих пор), бактериальных коинфекций, хозяина генетика, факторы окружающей среды и иммунопатогенез (рис. ).

Возможные детерминанты тяжести COVID-19. Многие факторы могут способствовать тяжести инфекций нижних дыхательных путей.Последовательность вирусного генома и степень репликации вируса (вирусная нагрузка) могут влиять на тяжесть и инициировать воспалительную реакцию, которая может вызвать иммунопатологию. Микробиом дыхательных путей и бактериальные коинфекции также могут усиливать тяжесть заболевания. Некоторые хозяева более восприимчивы к тяжелым заболеваниям из-за генетических факторов и факторов окружающей среды.

Резюме

Эпидемии SARS и MERS позволили нам лучше реагировать на COVID-19. Прозрачность, продемонстрированная при быстром обмене генетической информацией о SARS-CoV-2, сыграла решающую роль в выработке глобального подхода к минимизации распространения болезни.Это позволило быстро разработать диагностические тесты и внедрить их по всему миру. В свою очередь, эти диагностические тесты облегчили ведение случаев в наиболее пострадавших районах и выявление случаев в других странах, что помогло ограничить глобальное распространение SARS-CoV-2. Однако текущие данные указывают на то, что одних только этих мер общественного здравоохранения может быть недостаточно для ликвидации COVID-19. Срочно необходимы новые методы лечения, и время, которое мы выиграли благодаря мерам общественного здравоохранения, необходимо использовать продуктивно.Текущие клинические испытания существующих лекарств могут обеспечить дальнейшие прорывы в ограничении заболеваемости и смертности, но для предотвращения распространения инфекций могут потребоваться вакцины и профилактические средства.

Выводы

Менее чем за два месяца SARS-CoV-2 распространился в 29 странах и вызвал гораздо большую заболеваемость и смертность, чем SARS или MERS, несмотря на быструю идентификацию и надежные меры общественного здравоохранения. Перспективы неясны, но дальнейшее глобальное распространение кажется вероятным, и мы должны быть готовы противостоять этой угрозе.Продолжая задерживать распространение болезни, мы должны быстро инициировать исследования потенциальных терапевтических средств и развивать наше понимание патогенеза COVID-19.

Примечание

Все цифры в этой статье верны на 24 февраля 2020 года. Поскольку ситуация с COVID-19 меняется ежедневно, читателям рекомендуется обращаться к веб-сайтам, указанным в справочных материалах, для получения самой последней информации. .

Ссылки

22. Араби, Ю.М. и др., Am. J Respir Crit Care Med.2018. 197: 757–767. [PubMed] [Google Scholar]

Распространение вируса ближневосточного респираторного синдрома (БВРС-КоВ) в дыхательных путях: наблюдательный анализ с последствиями инфекционного контроля

https://doi.org/10.1016/j.ijid.2014.10.002Get права и содержание

Резюме

Исходная информация

С момента первого описания коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) неизвестно, как долго пациенты выделяют вирус с респираторными выделениями.Таким образом, мы проанализировали имеющиеся данные о времени до отрицательного результата теста на БВРС-КоВ у пациентов с подтвержденной инфекцией БВРС-КоВ и бессимптомными положительными контактами.

Методы

Были зарегистрированы данные повторных лабораторных исследований респираторных образцов, полученных в вирусологической референс-лаборатории Саудовской Аравии в Джидде, Королевство Саудовская Аравия, с 1 сентября 2012 г. по 31 сентября 2013 г. Был использован тест ОТ-ПЦР в реальном времени на БВРС-КоВ. Данные были проанализированы по происхождению образца, типу образца и результатам ПЦР-теста на БВРС-КоВ.

Результаты

Двадцать шесть человек (13 пациентов и 13 контактов) прошли повторное тестирование до получения отрицательного результата. Большинство образцов от больных БВРС-КоВ представляли собой трахеальный аспират/мокроту ( p  = 0,0006), а большинство образцов от контактов представляли собой мазки из носа и горла ( p  = 0,0002). Анализ кривой Каплана-Мейера показал, что контакты избавлялись от вируса намного раньше, чем пациенты. На 12-й день 30% контактов и 76% случаев по-прежнему были положительными на БВРС-КоВ по данным ПЦР.

Выводы

Контакты избавились от БВРС-КоВ раньше, чем больные пациенты. Этот вывод может быть связан с типами выборки, а также с типами исследуемых пациентов. Более больные пациенты со значительными сопутствующими заболеваниями выделяют вирус в течение значительно более длительного времени. Результаты этого исследования могут иметь решающее значение для руководства по инфекционному контролю и его применения в медицинских учреждениях, занимающихся положительными случаями.

Ключевые слова

Ближний Восток

БВРС-КоВ

ОТ-ПЦР

Коронавирус

Вирусная кинетика

Рекомендуемые статьиСсылки на статьи Авторы (0)

Copyright © s.Опубликовано Elsevier Ltd.

Рекомендованные статьи

Ссылки на статьи

Роль спайкового гликопротеина коронавируса ближневосточного респираторного синдрома человека (БВРС-КоВ) в проникновении вируса и формировании синцитий

Цитирование: Qian Z, Dominguez Холмс К.В. (2013) Роль спайкового гликопротеина коронавируса ближневосточного респираторного синдрома человека (БВРС-КоВ) в проникновении вируса и формировании синцитий. ПЛОС ОДИН 8(10): е76469. https://дои.org/10.1371/journal.pone.0076469

Редактор: Сяофэн Жэнь, Северо-восточный сельскохозяйственный университет, Китай

Получено: 24 июня 2013 г.; Принято: 29 августа 2013 г.; Опубликовано: 3 октября 2013 г.

Авторское право: © 2013 Qian et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Эта работа была частично поддержана Программой грантов штата Колорадо по оценке биологических открытий (HB-07-1001) и грантом NIH K08 AI-073525 для SRD. Спонсоры не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Коронавирусы вызывают респираторные, кишечные, почечные и/или неврологические заболевания у людей, многих других млекопитающих и птиц.В 2002–2003 годах из резервуара диких животных появился ранее неизвестный коронавирус, вызвавший пандемию атипичной пневмонии, в результате которой погибло около 8000 человек и более 770 человек [1,2]. Ранее межвидовая передача от коронавирусов летучих мышей и крупного рогатого скота позволила респираторным коронавирусам человека OC43, NL63 и 229E закрепиться в человеческой популяции во всем мире [3–8]. На Аравийском полуострове в 2012 году другой новый человеческий CoV, который теперь называется коронавирусом ближневосточного респираторного синдрома (MERS-CoV), был выделен в клетках Vero E6 из мокроты от смертельного случая тяжелого респираторного заболевания с почечной недостаточностью.С тех пор РНК БВРС-КоВ была обнаружена с помощью ОТ-ПЦР у более чем 70 пациентов с респираторными заболеваниями тяжелой и средней степени тяжести, 39 из которых умерли [9,10]. Анализ последовательности генома показал, что MERS-CoV является новым бета-коронавирусом в геногруппе с, тесно связанным с двумя прототипами бета-коронавирусов группы с азиатских летучих мышей, BtCoV-HKU4 от летучей мыши Tylonycteris pachypus и BtCoV-HKU5 от летучей мыши Pipistrellus abramus [1]. 11], а также к частичным последовательностям бета-коронавируса группы с от летучей мыши Pipistrellus pipistrellus в Нидерландах [12].Недавно бета-коронавирусы группы с были также обнаружены у летучей мыши Nyctinomops laticaudatus в Мексике [13] и Nycyteris cf. gambiensis летучих мышей в Гане [14]. MERS-CoV, как и SARS-CoV, вероятно, является зоонозным бета-коронавирусом, который прямо или косвенно попал в организм человека от одного из видов летучих мышей, несущих бета-коронавирусы группы с, или из других неизвестных животных-резервуаров [13,15,16]. .

Спайковый гликопротеин (S) коронавирусов ~ 200 кДа является важной детерминантой вирулентности вируса, тропизма к тканям и круга хозяев.Тримеры S образуют характерные большие шипы на оболочке коронавируса, которые связываются с рецепторами, опосредуют слияние мембран, проникновение вируса и образование синцитиев, а также вырабатывают антитела, нейтрализующие вирус. S-белки коронавируса представляют собой вирусные слитые белки класса I, такие как оболочка ВИЧ (env), гемагглютинин гриппа (HA) и слитые гликопротеины парамиксовируса (F) [17], которые обычно требуют расщепления протеазой между доменами S1 и S2 (рис. 1A), чтобы разрешить конформационные изменения в S2, активируемые связыванием рецептора и/или низким pH, которые опосредуют слияние мембран, приводящее к проникновению вируса и образованию синцитиев [3,17,18].В различных типах клеток и тканях S-белки коронавируса могут расщепляться различными протеазами хозяина, включая фурин, трипсин, трипсиноподобную протеазу дыхательных путей человека (HAT), трансмембранную протеазу, серинпротеазу-2 (TMPRSS-2), TMPRSS-4, или катепсины [18–22]. Функциональный анализ гликопротеина S БВРС-КоВ необходим для выявления восприимчивых типов клеток и видов-хозяев, которые влияют на тропизм вирусной ткани и круг хозяев, а также для определения того, как различные протеазы хозяина способствуют проникновению вируса БВРС-КоВ и образованию синцитий.

Рисунок 1. Включение белка S∆16 MERS-CoV в псевдовирионы (A) Схема полноразмерного белка S∆16 MERS-CoV и белка S∆16 MERS-CoV с заменой 16 аминокислот на С-конце линкером и меткой FLAG.

S1, домен прикрепления вируса; S2, домен слияния мембран; ТМ, трансмембранный домен. (B) Обнаружение нерасщепленного белка MERS-CoV SΔ16 в клетках и псевдовирионах. Дорожки 1 и 5, контрольные псевдовирионы без шипа; дорожки 2 и 6, псевдовирионы MERS; дорожки 3 и 7, лизат клеток 293Т, продуцирующих псевдовирионы MERS; дорожки 4 и 8, лизат клеток 293Т, продуцирующих контрольные псевдовирионы без шипа.Дорожки с 1 по 4 блоттировали анти-FLAG; и дорожки 5-8, с поликлональным козьим антителом AO4 к S-белку MHV-A59. * указывает на возможный тример белка S БВРС-КоВ в псевдовирионах. В псевдовирионах, полученных в клетках 293Т, белок S ~200 кДа не расщеплен. (C) Идентификация домена белка S MERS-CoV, который распознается поликлональными антителами к шиповидному белку MHV. Укороченные S-белки БВРС-КоВ с С-концевыми метками FLAG собирали из среды над трансфицированными клетками, анализировали с помощью SDS-PAGE, а затем подвергали блотингу с антителами против FLAG или AO4.Лизат клеток 293T, экспрессирующих кодон-оптимизированный MERS S∆16 полной длины, показан на дорожке 1 в качестве положительного контроля для распознавания MERS S с помощью AO4.

https://doi.org/10.1371/journal.pone.0076469.g001

Идентификация рецептора или рецепторов является важным первым шагом в понимании диапазона хозяев и тканевого тропизма коронавирусов. В настоящее время известны четыре рецепторных белка для шиповидных белков различных коронавирусов: мышиная карциноэмбриональная антигенная молекула клеточной адгезии 1a (mCEACAM1a) для вируса гепатита мыши (MHV) [23], бетакоронавируса группы а; аминопептидаза N (APN) для коронавируса человека 229E (HCoV-229E) и некоторых других альфа-коронавирусов [24,25]; и ангиотензинпревращающий фермент 2 (ACE2) как для SARS-CoV, бета-коронавируса в группе b, так и для HCoV-NL63, альфа-коронавируса [26,27].Raj и его коллеги [28] недавно продемонстрировали, что MERS-CoV использует дипептидилпептидазу 4 (DPP4) в качестве рецептора. Напротив, S-белки нескольких бета-коронавирусов группы а, включая бычий коронавирус и hCoV-OC43, используют фрагменты сиаловой кислоты в качестве рецепторов [29,58]. Мы использовали псевдотипы лентивирусов с шиповидным гликопротеином MERS-CoV для идентификации клеток, восприимчивых к заражению MERS-CoV, и для изучения роли S-белка MERS во внедрении вируса и формировании синцитиев.

Результаты

Экспрессия гликопротеина спайка (S) БВРС-КоВ и включение в псевдовирионы лентивируса

Экспрессия белков коронавируса S на клеточных мембранах 293T для включения в псевдовирионы лентивируса может быть усилена за счет использования кодон-оптимизированной шиповой кДНК и делеции мотива удержания ER/Гольджи и мотива рециркуляции эндосом из цитоплазматического хвоста S [30–32].Кодон-оптимизированная кДНК, кодирующая S MERS-CoV (получена из GenBank: AFS88936) [15], с заменой 16 С-концевых аминокислот линкером, GGGGS и меткой FLAG (здесь называемой MERS-CoV SΔ16) (рис. 1А) экспрессировался на клеточных мембранах 293Т и включался в оболочки псевдовирионов лентивируса. Иммуноблоттинг гелей SDS-PAGE клеточного лизата (рис. 1B, дорожка 3) с анти-FLAG выявил две полосы SΔ16 БВРС-КоВ с молекулярной массой около 200 кДа, которые, вероятно, отражают изменения в гликозилировании SΔ16 во время транспорта через аппарат Гольджи.Только верхняя полоса S была включена в псевдовирионы MERS (рис. 1B, дорожка 2). В трансфицированных клетках 293T или псевдовирионах не было обнаружено продуктов расщепления протеазой белка S ~ 200 кДа (рис. 1В). Напротив, псевдовирионы лентивируса БВРС, используемые для идентификации клеток, восприимчивых к проникновению БВРС-КоВ в лаборатории Пельмана [33], содержали высокую долю расщепленного S-белка БВРС-КоВ с молекулярной массой около 100 кДа. Это важное различие в псевдовирионах MERS, вероятно, связано с различиями между нашими клетками 293T и теми, которые использовались в лаборатории Пельмана.Неожиданно, когда эти псевдовирионы MERS и клеточные лизаты были подвергнуты блотингу поликлональным козьим антителом AO4 к шипам, очищенным от разрушенных детергентом вирионов MHV-A59, бета-коронавируса в группе А, были обнаружены полосы белка MERS S (рис. 1B). Иммуноблоттинг растворимых укороченных белков MERS S с С-концевыми метками FLAG показал, что антитело AO4 не распознает домен S1 MERS S (рис. 1C), поэтому перекрестная реактивность между этими белками бета-коронавирусов групп a и c должна находиться в пределах домен S2.

Псевдовирионы MERS идентифицируют клеточные линии, обладающие активностью рецептора MERS-CoV

Линии клеток почек обезьян

Vero E6 и LLCMK2 чувствительны к заражению вирусом MERS-CoV и SARS-CoV [10,34], а также чувствительны к псевдовирионам SARS и псевдовирионам MERS с нерасщепленным S-белком (рис. 2A). Вхождение клеток количественно оценивали по экспрессии репортерного гена люциферазы в трансдуцированных псевдовирусом клетках. По сравнению с контрольными псевдовирионами без шиповидного белка псевдовирионы MERS показали увеличение активности люциферазы в 100–1000 раз в клетках Vero E6 и LLCMK2 (рис. 2A и B), а псевдовирионы SARS показали увеличение активности люциферазы в 1000 раз в клетках Vero E6.Поскольку проникновение вируса в клетки Vero E6 и LLCMK2 опосредовано нерасщепленным белком S MERS-CoV, трансдукция псевдовирионами MERS использовалась для идентификации дополнительных клеточных линий, которые экспрессируют функциональные рецепторы для MERS-CoV [10,34]. Псевдовирионы БВРС обнаружили сильную рецепторную активность БВРС-КоВ на линии Calu3 эпителиальных клеток дыхательных путей человека (рис. 2А и В) и более слабую рецепторную активность на линии А549 альвеолярных базальных эпителиальных клеток человека (рис. 2А), что также показано с помощью БВРС-КоВ. инфекции [35]. Интересно, что линия эмбриональных клеток EFF от летучих мышей Eptesicus fuscus была чувствительна к псевдовирионам MERS, повышая активность люциферазы почти в 100 раз по сравнению с контролем без шипов, но линия клеток легкого TB1Lu от летучих мышей Tadarida brasiliensis , мышиных фибробластов и Клетки HeLa не были восприимчивы к псевдовирионам MERS (рис. 2С).Экспрессия человеческого ACE2 в клетках 293T не приводила к значительному повышению восприимчивости к псевдовирионам MERS (рис. 3A), хотя, как и ожидалось, hACE2 значительно повышала восприимчивость клеток 293T к псевдовирионам SARS (рис. 3A). На рис. 3B и C показано, что ни CEACAM1 человека, ни четыре родственных белка CEACAM человека, ни APN человека не функционируют в качестве рецептора спайкового белка MERS-CoV. Эти эксперименты подтверждают наблюдение, что MERS-CoV не использует рецепторные белки, известные для других коронавирусов [33], или родственные мембранные белки человека.Вместо этого DPP4 является основным белком-рецептором MERS-CoV [28]. Псевдовирионы MERS индуцировали небольшое, но последовательное 5-10-кратное увеличение активности люциферазы в клетках почек эмбриона человека 293T по сравнению с контрольным вирусом без спайков (рис. 2C), что свидетельствует о том, что наши клетки 293T экспрессировали либо низкий уровень DPP4, либо альтернативный но менее эффективный рецептор, такой как CD209L или LSECtin для SARS-CoV [36,37].

Рисунок 2. Введение в клетки человека, обезьяны и летучей мыши псевдовирионов с гликопротеинами SARS-CoV, VSV или MERS-CoV.

(A) Проникновение псевдовирионов SARS (синий), MERS-CoV (красный) или контроля без шипа (белый) в 293/hACE2 (клетки 293, стабильно экспрессирующие hACE2, рецептор SARS-CoV), Vero E6, LLCMK2, Calu3 , и линии клеток A549. Проникновение псевдовируса количественно оценивали по активности люциферазы через 40 часов после инокуляции (pi). (B) Проникновение псевдовирионов MERS-CoV (красный) или контроля без шипа (белый) в клетки HeLa, экспрессирующие 6 различных белков CEACAM человека, клетки Calu3, LLCMK2 и Vero E6. (C) Попадание псевдовирионов VSV (черный), MERS-CoV (красный) или контроля без шипа (белый) в разные клеточные линии: 293T, NIh4T3, NIh4T3/Vector (трансфецированные пустым вектором), NIh4T3/hAPN (стабильно экспрессирующие человеческие APN), EFF летучих мышей (клетки эмбрионов из Eptesicus fuscus ) и TB1Lu летучих мышей (клетки легких из Tadarida brasiliensis ).

https://doi.org/10.1371/journal.pone.0076469.g002

Рисунок 3. Ингибирование проникновения псевдовирионов MERS лизосомотропными агентами или ингибиторами катепсина.

(A) Введение в клетки Vero E6 псевдовирионов с S-белком SARS, нерасщепленным S-белком MERS-CoV или без контрольного пика в присутствии 20 мМ NH 4 Cl (столбцы с восходящими полосами), 200 нМ бафиломицина A (столбики с горизонтальные полосы) или только среда (без контроля ингибитора, белые полосы). (B) Влияние ингибиторов катепсина на проникновение псевдовирионов с нерасщепленным белком S MERS-CoV, S белком SARS или VSV-g.Ингибитор катепсина широкого спектра действия, E64D, или специфический ингибитор катепсина L, ингибитор катепсина L III (черные столбцы) снижал проникновение псевдовирионов MERS и SARS, но не ингибировал проникновение псевдовирионов VSV по сравнению с контролем без ингибитора (белые столбцы). Попадание вируса количественно оценивали по активности люциферазы через 40 ч после заражения.

https://doi.org/10.1371/journal.pone.0076469.g003

Эффекты ингибиторов закисления эндосом на проникновение псевдовирионов MERS

Чтобы определить, требует ли проникновение псевдовирионов MERS с нерасщепленным белком S эндоцитоза и закисления в эндосомах, были изучены эффекты хлорида аммония и бафиломицина А, лизосомотропных агентов, которые ингибируют закисление эндосом.В клетках Vero E6 20 мМ NH 4 Cl ингибировали проникновение псевдовирионов SARS примерно на 99,9 % по сравнению с проникновением псевдовирионов SARS без ингибитора, а NH 4 Cl также ингибировало проникновение псевдовирионов MERS примерно на 99,6 % (рис. 3A). Бафиломицин А специфически ингибирует Н+-АТФазу вакуолярного типа, которая необходима для подкисления лизосом. На рисунке 3А показано, что бафиломицин А ингибировал проникновение псевдовирионов SARS в клетки Vero E6 на 99,8%, как сообщалось ранее [21,38], а также ингибировал проникновение псевдовирионов MERS более чем на 99%.9% по сравнению с псевдовирионами MERS без ингибитора. В клетках LLCMK2, хотя бафиломицин А ингибировал 99,7% проникновения, опосредованного MERS-CoV S, NH 4 Cl снижал проникновение, опосредованное MERS-CoV S, только в 6 раз (данные не показаны), что позволяет предположить, что ингибирование эндосомального закисления с помощью NH 4 Cl может зависеть от типа клеток. Эти эксперименты показывают, что псевдовирионы MERS с нерасщепленным S-белком могут проникать в клетки почек обезьян только путем эндоцитоза.

Для проникновения псевдовирионов MERS в эндосомы требуется расщепление S катепсином L

Катепсины представляют собой разнообразную группу активируемых кислотой цистеиновых протеаз, локализованных в эндосомах и лизосомах.Активность катепсина необходима для инфекции несколькими вирусами, проникающими эндосомальным путем, включая реовирус [39], SARS-CoV [22] и эболавирус [40]. E64D, ингибитор цистеиновой протеазной активности катепсинов B, H и L и кальпаина, снижал трансдукцию клеток Vero E6 псевдовирионами SARS на 80%, как сообщалось ранее (рис. 3B) [41]. Поскольку проникновение в клетки, опосредованное гликопротеином VSV-g, не требует активации протеазы [17], обработка E64D клеток Vero E6 (рис. 3B) и LLCMK2 (данные не показаны) не ингибировала проникновение псевдовирионов VSV.Однако E64D снижал проникновение в клетки Vero E6 псевдовирионов MERS с нерасщепленным S на 96,7% (рис. 3B) и клеток LLCMK2 на 99,2% (данные не показаны). Таким образом, расщепление S-белка MERS-CoV одним из катепсинов или кальпаином было необходимо для запуска S-опосредованного слияния мембран и проникновения вируса при низком pH в эндосомах. Как сообщалось ранее [41], в клетках Vero E6 10 мкМ ингибитора катепсина L III, специфического и необратимого ингибитора катепсина L, значительно ингибировали вход, опосредованный S-белком SARS, но не ингибировали вход, опосредованный VSV-g (рис. 3B). ).Ингибитор катепсина L III снижал проникновение в клетки Vero E6 псевдовирионов MERS с нерасщепленным белком S на 97% по сравнению с проникновением без ингибитора (рис. 3B), и аналогичные результаты наблюдались в клетках LLCMK2 (данные не показаны). Таким образом, S-белок БВРС-КоВ на псевдовирионах должен быть расщеплен в эндосомах под действием активируемой кислотой цистеиновой протеазы катепсина L, чтобы вызвать рецептор-зависимое проникновение в клетки Vero E6 и LLCMK2.

Расщепление вируса БВРС-КоВ трипсином на псевдовирионах, адсорбированных на рецепторах на поверхности клетки, запускает проникновение вируса в плазматическую мембрану при нейтральном рН

SARS-CoV может проникать в восприимчивые клетки через плазматическую мембрану, а не путем эндоцитоза, если вирионы, адсорбированные при 4°C на ACE2 на клеточной мембране, обработать трипсином, а затем нагреть до 37°C в присутствии ингибитора эндосомального подкисление [21].Обработка трипсином при 4°C или 37°C расщепляла S-белок псевдовирионов MERS и образовывала субъединицу ~65 кДа в S2-домене белка, распознаваемого антителом к ​​S-белку MHV-A59 (рис. S1). Псевдовирионы MERS с нерасщепленным белком S адсорбировали при 4°C на рецепторах клеточной поверхности клеток Vero E6 в присутствии 20 мМ NH 4 Cl, а затем клетки со связанными вирионами кратковременно обрабатывали трипсином при pH 7,4 при комнатной температуре до расщепляют белок S ~ 200 кДа и активируют его активность слияния мембран.На рисунках 3A и 4A показано, что NH 4 Cl сильно ингибирует инфицирование клеток Vero E6 псевдовирионами MERS с нерасщепленным S. Однако обработка трипсином псевдовирионов MERS, связанных при нейтральном pH и 4°C с клеточной мембраной Vero E6, запускала оба вируса. проникновение в плазматическую мембрану и образование небольших синцитиев через 40 часов после инокуляции (рис. 4А и В). Таким образом, связывание рецептора вместе с расщеплением протеазой и активацией S при нейтральном pH было достаточно, чтобы вызвать проникновение псевдовирионов MERS и образование синцитиев.В этом эксперименте слияние мембран не зависело от синтеза S-белка, но образование синцитиев было опосредовано расщепленным S-белком на псевдовирионах, адсорбированных вирусным рецептором на клеточной мембране. Хотя кислый pH необходим для активации активности катепсина L, которая позволяет псевдовирионам MERS проникать в эндосомы, низкий pH не требуется для конформационных изменений расщепленного трипсином S-белка MERS-CoV, которые опосредуют проникновение в плазматическую мембрану.

Рис. 4. Активация трипсином проникновения псевдовирионов MERS в плазматическую мембрану при нейтральном pH и опосредованное MERS-CoV S образование синцитиев.

(A) Псевдовирионы MERS или контрольные псевдовирионы без пиков были адсорбированы на клетках Vero E6 при 4°C, затем кратковременно обработаны трипсином или только средой, а затем ингибитором трипсина в присутствии или в отсутствие NH 4 Cl для подавления подкисления эндосом. Проникновение псевдовируса количественно оценивали по активности люциферазы через 40 часов после инфицирования. (B) В том же эксперименте добавление трипсина активировало S-опосредованное образование рассеянных синцитиев (черные стрелки) в клетках Vero E6 с адсорбированными псевдовирионами MERS как в присутствии, так и в отсутствие NH 4 Cl через 40 ч после заражения.(C) клетки 293T, стабильно трансфицированные плазмидой, кодирующей белок SΔ16 БВРС-КоВ, или без спайка, предварительно кратковременно обрабатывали трипсином при 4°C, затем ингибитором трипсина сои, а затем совместно культивировали с клетками Vero E6 в течение 20 часов, или совместно культивировали с клетками Vero E6 в течение 20 часов в постоянном присутствии трипсина. Для образования синцитиев требовалась экспрессия на клетках Vero E6 рецептора MERS-CoV, а также расщепление трипсином S-белка MERS-CoV, но не требовался кислый pH.

https://дои.org/10.1371/journal.pone.0076469.g004

Расщепление трипсином S-белка MERS-CoV, экспрессируемого на клеточной поверхности, вызывает образование синцитиев в клетках Vero E6

Клетки

293T, экспрессирующие нерасщепленный белок S MERS-CoV, или контрольные клетки, стабильно трансфицированные пустым вектором pcDNA3.1, накладывали на монослои клеток Vero E6 в присутствии или в отсутствие трипсина TPCK (рис. 4C). Клетки 293T с пустым вектором или клетки 293T, экспрессирующие MERS-CoV SΔ16 без трипсина, не индуцировали образования синцитиев (рис. 4C), но добавление трипсина TPCK в среду вызывало образование массивных синцитиев в клетках Vero E6, совместно культивируемых в течение 20 часов. с S-экспрессирующими клетками 293T MERS-CoV (рис. 4C, стрелки).Крупные синцитии также образовывались даже после кратковременной 20-минутной предварительной обработки трипсином при pH 7,4 и 4°C клеток 293T, экспрессирующих S-белок MERS-CoV, с последующей инкубацией с 5-кратным избытком соевого ингибитора трипсина перед наслоением клеток на конфлюэнтных монослоев клеток Vero E6 и инкубации при 37°C в течение 20 часов (рис. 4C, нижняя центральная панель, стрелки). Таким образом, расщепление трипсином белка S MERS-CoV на клетках 293T при нейтральном значении pH запускало образование синцитиев, когда S связывался с рецепторами на восприимчивых клетках Vero E6.

Влияние TMPRSS-2 и -4 на проникновение псевдовируса MERS и образование синцитиев клеток 293T

Трансмембранные сериновые протеазы II типа, включая TMPRSS-2 и TMPRSS-4, которые, как и трипсин, экспрессируются в дыхательных путях, играют важную роль в инициировании проникновения вируса гриппа А, метапневмовируса человека и бета-коронавируса SARS в группе b [19,20, 42–45]. Поэтому мы трансфицировали клетки 293T плазмидами, кодирующими TMPRSS-2 или -4, белок MERS-CoV SΔ16, psPAX2 и pLenti-GFP-Luc, и исследовали, расщепляются ли S-белки на псевдовирионах, продуцируемых в этих клетках, и могут ли они инфицировать клетки Vero E6 в присутствие NH 4 Cl.Удивительно, но клетки 293T, продуцирующие псевдовирион, экспрессирующие TMPRSS-2 или -4, образовывали большие синцитии через 40 часов после трансфекции (рис. 5А), но псевдовирионы MERS, продуцируемые этими клетками, не могли трансдуцировать клетки Vero E6 в присутствии или в отсутствие NH 4 Cl (фиг. 5В). Напротив, без TMPRSS-2 или -4 клетки 293T, экспрессирующие нерасщепленный MERS-CoV SΔ16, не образовывали синцитий и псевдовирионов, которые они продуцировали, эффективно инфицируя клетки Vero E6, но проникновение вируса ингибировалось NH 4 Cl (рис. 5B). ).Иммуноблоты с антителами AO4 к MHV S или анти-FLAG (данные не показаны) выявили, что псевдовирионы MERS, продуцируемые клетками 293T, экспрессирующими TMPRSS-2 или -4, содержали небольшое количество или не содержали иммунореактивного белка S или фрагментов S.

Рис. 5. Влияние TMPRSS-2 и TMPRSS-4 на S-опосредованное MERS-CoV образование синцитий в клетках 293T и проникновение псевдовируса MERS в клетки Vero E6.

(A) Коэкспрессия в клетках 293T трансмембранных сериновых протеаз TMPRSS-2 или TMPRSS-4, а также псевдовирионов MERS индуцировала образование синцитиев в клетках 293T, экспрессирующих репортерный ген GFP, визуализируемых через 40 часов после трансфекции.(B) псевдовирионы MERS или контрольные псевдовирионы без шипов, высвобождаемые из клеток на рисунке 5A, инокулировали в клетки Vero E6 в присутствии (полосатые столбцы) или в отсутствие (белые столбцы) 20 мМ NH 4 Cl для ингибирования подкисления эндосом.

https://doi.org/10.1371/journal.pone.0076469.g005

Обсуждение

Хотя новый бета-коронавирус MERS-CoV группы с обладает высокой вирулентностью для человека и может инфицировать клетки нескольких различных видов, включая людей, обезьян, свиней и некоторые виды летучих мышей [10,16,34], об этом известно немного. о биологии этого вируса.Поскольку гликопротеин спайка необходим для проникновения коронавируса, выяснение функций спайка БВРС-КоВ может дать ценную информацию о патогенезе БВРС-КоВ и предложить возможные терапевтические вмешательства. Здесь мы использовали псевдовирионы лентивируса с шиповидным белком MERS-CoV для изучения S-опосредованного проникновения в клетку на уровне биобезопасности 2.

Мы обнаружили, что псевдовирионы MERS, как и инфекционные вирионы MERS-CoV [10,34], легко инфицировали линии клеток почек обезьян Vero E6 и LLCMK2, несколько линий клеток респираторного эпителия человека и клетки эмбрионов летучих мышей Eptesicus fuscus .Другие также недавно продемонстрировали, что клетки дыхательных путей человека, а также первичные клетки бронхов и альвеол восприимчивы к БВРС-КоВ в связи с тяжелым респираторным заболеванием у пациентов с БВРС [10,33,35,46]. Мюллер и др. [34] недавно сообщили, что MERS-CoV может инфицировать клетки четырех родов летучих мышей Старого Света, Rousettus, Rhinolophus, Pipistrellus и Myotis , и одного рода Нового Света, Carollia . Мы обнаружили, что псевдовирионы MERS могут также инфицировать клетки одной летучей мыши Нового Света, E.fuscus , но не от другого, T. brasiliensis . Способность БВРС-КоВ заражать клетки многих видов млекопитающих напрямую и без адаптации [47], в том числе различных видов летучих мышей как Старого, так и Нового Света, позволяет предположить, что рецептор БВРС-КоВ, ДПП4 [28], широко распространен. сохраняется у многих видов, что является важным свойством многих новых вирусов [47,48]. Летучие мыши E. fuscus , широко известные как большие коричневые летучие мыши, являются летучими мышами, наиболее часто встречающимися людьми в Северной Америке, и они являются резервуаром альфа-коронавируса [49,50].Будет важно узнать, восприимчивы ли эти летучие мыши Нового Света к MERS-CoV или родственным бета-коронавирусам группы c. Недавнее обнаружение у 90 209 летучих мышей N. laticaudatus 90 210 в Мексике бета-коронавируса группы c с 96% сходством с MERS-CoV [13] в сочетании с разнообразным набором альфа-коронавирусов, ранее обнаруженных у летучих мышей Северной Америки [49–52], оправдывает увеличение наблюдения для выявления дополнительных видов летучих мышей Нового Света, которые также могут быть носителями бета-коронавирусов группы c, таких как MERS-CoV, или других коронавирусов, способных вызывать тяжелые заболевания у людей.

MERS-CoV представляет собой бета-коронавирус в группе с, и мы были удивлены тем, что его белок S был распознан в иммуноблотах поликлональными антителами к шиповидному белку MHV-A59, группе бета-коронавирусов. Перекрёстно-реактивный эпитоп(ы) был картирован в домене S2, который является более консервативным, чем домен S1 бета-коронавирусов. Чан и др. [33,53] обнаружили, что S-белок БВРС-КоВ распознается в иммунофлуоресцентных анализах и анализах нейтрализации in vitro в сыворотке некоторых выздоравливающих пациентов с атипичной пневмонией, и предположили, основываясь на биоинформатике, что эпитоп(ы) в S2 может объяснить наблюдаемое серологическая перекрестная реактивность.Эти наблюдения о том, что S-белок MERS-CoV, бета-коронавируса группы c, содержит перекрестно реагирующий эпитоп(ы) с S-белками некоторых бета-коронавирусов группы b (SARS-CoV) и группы a (MHV), указывают на то, что серологические исследования могут не точно различать разные филогенетические группы бетакоронавирусов. Идентификация и характеристика перекрестно реагирующего эпитопа (эпитопов) является важным приоритетом исследований, чтобы показать, существует ли общий эпитоп в S, который можно было бы использовать в качестве иммуногена для вакцинации против всех бета-коронавирусов.

Вирусы с оболочкой заражают клетки путем слияния вирусной оболочки с мембранами клетки-хозяина, процесс, опосредованный серией конформационных изменений в вирусном слитом белке, которые регулируются связыванием с рецептором, активацией протеазы и/или рН [17]. Классы белков слияния вирусов определяются на основании их структуры и конформационных изменений во время слияния мембран. Большинству слитых белков вирусов класса I требуется протеолитическое расщепление перед гидрофобным слитым пептидом в вирусном шиповидном белке, чтобы обеспечить возможность этих конформационных изменений, а также последующие этапы, которые запускают слияние мембран, включая либо связывание с рецептором, таким как gp120 ВИЧ, низкий pH в эндосомах. как HA гриппа, или оба, как вирус птичьего лейкоза саркомы (ASLV) [9,17,54-56].Коронавирусы в разных филогенетических группах различаются последовательностью шагов, ведущих к проникновению вируса [57,58]. Белок S на вирионах группы бета-коронавируса MHV-A59 нуждается в активации протеазы — либо фурином во время созревания вируса [18], либо трипсином или другими сериновыми протеазами во внеклеточной жидкости до связывания с рецептором, либо катепсином в эндосомах при кислом рН — запускать конформационные изменения, которые приводят к слиянию мембран и проникновению вируса [59]. Напротив, вирионы бета-коронавируса SARS-CoV группы b, содержащие нерасщепленный S [22], сначала связываются с белком вирусного рецептора ACE2 и подвергаются эндоцитозу, а затем S расщепляется внутри эндосомальных везикул кислотозависимым катепсином L, что обеспечивает конформационную конформацию. изменения в S, которые приводят к проникновению вируса [21,22,60].

Здесь мы проанализировали шаги, необходимые для запуска конформационных изменений в S MERS-CoV, и их роль во внедрении вируса и формировании синцитиев. В нашей лаборатории псевдовирионы MERS, высвобождаемые клетками 293T, содержали только нерасщепленный белок S, и, как и для большинства коронавирусов, расщепление между S1 и S2 было необходимо для активации его активности по слиянию мембран. Псевдовирионы MERS связывались с рецепторами на восприимчивых клетках и подвергались эндоцитизации, а внутри эндосом расщепление S с помощью кислотозависимой цистеиновой протеазы, опосредованной проникновением вируса катепсином L.Gierer et al [33] пришли к аналогичным выводам, используя псевдовирионы MERS, которые, в отличие от наших, содержали больше расщепленного, чем нерасщепленного белка S, хотя обе лаборатории создали псевдовирионы в клетках 293T. Гирер и др. [33] показали, что партии клеток 293T заметно различаются по экспрессии рецептора MERS-CoV и восприимчивости к трансдукции псевдовирионами MERS. В нашей лаборатории клетки 293T показали минимальную восприимчивость к трансдукции псевдовирионами MERS-CoV с нерасщепленным белком S.

Помимо проникновения путем эндоцитоза, мы показали, что, подобно SARS-CoV [21,22], псевдовирионы MERS могут проникать в восприимчивые клетки Vero E6 через плазматическую мембрану, если вирионы сначала связываются с рецепторами клеточной поверхности при 4°C при нейтральном pH. в присутствии NH 4 Cl для ингибирования подкисления эндосом, а также кратковременно обрабатывали трипсином при комнатной температуре для расщепления вирусного S-белка.При нагревании до 37°С при нейтральном рН псевдовирионы MERS сливались с плазматической мембраной и трансдуцировали клетки. Таким образом, белок MERS S не требует подкисления для обеспечения проникновения вируса, а подкисление, необходимое для проникновения в эндосомы [33], необходимо для активации протеазной активности катепсина. Хотя обработка вирионов или псевдовирионов коронавируса протеазами может активировать проникновение вируса, она также может привести к потере их инфекционности, если расщепленный гетеродимер S1/S2 диссоциирует до связывания с рецептором.Мы обнаружили, что псевдовирионы MERS, высвобождаемые из клеток, экспрессирующих TMPRSS-2, содержат уменьшенное количество белка S и теряют способность трансдуцировать восприимчивые клетки. Мы предполагаем, что псевдовирионы MERS, которые содержат большое количество расщепленного белка S, обнаруживаемого с-концевой меткой [33, 53], не могут проникать в клетки через плазматическую мембрану, поскольку S1 мог диссоциировать от расщепленных шипов на вирионах. Для проверки этой гипотезы необходима разработка антител, специфичных к домену S1 белка MERS S.

S-белки коронавируса, экспрессируемые на клеточных мембранах, могут запускать рецептор-зависимое образование синцитиев, если связанный с мембраной S-белок расщепляется внутри инфицированных клеток фурином или другими протеазами. Заражение MERS-CoV клеточных линий Calu-3 и Caco-2 индуцировало образование синцитиев [35]. Наши клетки 293T были лишь минимально восприимчивы к проникновению псевдовирионов MERS и не образовывали синцитий при продукции псевдовирионов MERS с нерасщепленным S. Однако при совместном культивировании клеток 293T, экспрессирующих белок SΔ16 MERS-CoV, в присутствии трипсина с Vero E6 клеток, которые экспрессируют рецептор MERS-CoV, формируются огромные синцитии.Эти наблюдения позволяют предположить, что в таких тканях, как легкие, где доступны трипсин, TMPRSS-2 или -4, HAT и другие сериновые протеазы, вирусная инфекция MERS-CoV может распространяться непосредственно от клетки к клетке с помощью S-опосредованного, зависимого от рецептора синцития. , потенциально ускользая от вируснейтрализующих антител, как и другие вирусы, образующие синцитии, такие как респираторно-синцитиальный вирус, вирусы парагриппа и кори. Будет важно узнать, образуются ли синцитии в легких или других тканях пациентов с БВРС-КоВ или животных моделей БВРС-КоВ.

Некоторые S-белки коронавируса также могут запускать рецептор-независимое образование синцитиев [61,62]. Когда S-белки, экспрессированные на плазматической мембране, расщепляются, домен S1 может отделяться от шипа, обнажая гидрофобный слитый пептид прикрепленного к мембране домена S2, который может непосредственно индуцировать слияние с любыми близлежащими клеточными мембранами или липидными бислоями, даже если в них отсутствуют рецепторы. . Это «рецептор-независимое распространение (RIS)» позволяет инфицированной клетке сливаться с соседними неинфицированными, рецептор-отрицательными клетками, которые, в свою очередь, могут продуцировать вирус и сливаться с дополнительными рецептор-отрицательными клетками.Активность RIS зависит от стабильности взаимодействий S1/S2, а низкая стабильность гетеродимеров S1/S2 коррелирует с быстрым распространением инфекции через ткани, экспрессирующие мало рецепторного белка [63,64]. Мы обнаружили, что трансмембранные сериновые протеазы TMPRSS-2 и -4 могут активировать синцитийобразующую активность белка SΔ16 MERS-CoV, экспрессируемого в клетках 293T, как эти протеазы активируют слитые белки класса 1 других респираторных вирусов, включая грипп, SARS-CoV и метапневмовирус человека. [19,20,42–45].Мы были удивлены тем, что клетки 293T, которые экспрессируют очень мало рецептора MERS-CoV, были настолько сильно слиты, и мы предполагаем, что это образование синцитиев может быть связано с RIS.

Из-за высокого уровня смертности от БВРС-КоВ срочно необходимы терапевтические вмешательства. Объединенный очищенный человеческий иммуноглобулин, содержащий нейтрализующее антитело, использовался для лечения различных инфекционных заболеваний. Неудивительно, что поскольку MERS-CoV является новым патогеном, мы обнаружили, что человеческий иммуноглобулин из США не может нейтрализовать инфекционность псевдовирионов MERS (данные не представлены).Однако сыворотки пациентов, инфицированных SARS-CoV или MERS-CoV, содержат антитела, которые могут нейтрализовать MERS-CoV [33,53]. Большинство нейтрализующих антител, вероятно, будут нацелены на рецептор-связывающий домен S1 MERS-CoV S, который менее консервативен, чем домен S2, и может мутировать, вероятно, генерируя мутанты, ускользающие от антител [65]. Здесь мы показали, что поликлональное антитело к белку S MHV, группе бета-коронавирусов, перекрестно реагирует с доменом S2 белка MERS S в иммуноблотах. Как мы и другие исследователи предположили для SARS-CoV [66, 67], более консервативный домен S2 и особенно его С-концевой участок гептадного повтора (HRC) могут быть важными мишенями для блокирования конформационных изменений в S, ингибирующих образование синцитиев. проникновение вируса, а также образование нейтрализующих антител.Если вирионы БВРС-КоВ, образующиеся в легких, имеют нерасщепленный белок S и поэтому должны проникать в клетки посредством эндоцитоза, то ингибирующие пептиды HRC или нейтрализующие антитела к HRC могут не проникнуть в эндосомы, чтобы предотвратить проникновение вируса. Однако вирионы MERS-CoV в легких, вероятно, расщепляют белок S из-за легочных протеаз, поэтому проникновение вируса в плазматическую мембрану может быть ингибировано пептидами или антителами, нацеленными на HRC.

Таким образом, мы продемонстрировали, что, как и в случае с SARS-CoV, расщепление белка MERS-CoV-S трипсином, TMPRSS2 или -4 или катепсином L необходимо для активации активности слияния мембран S, что приводит к проникновению вируса и образованию синцитиев. , и что расположение протеазы определяет, проникает ли вирус через эндоцитоз или путем слияния с плазматической мембраной.S-опосредованные MERS-CoV механизмы связывания и проникновения, а также запуск протеазами конформационных изменений, необходимых для проникновения вируса MERS-CoV-S и образования синцитиев, представляют собой потенциальные мишени для разработки лекарств или вакцин против этого недавно появившегося летального бета-коронавируса человека группы c.

Материалы и методы

Конструкции и плазмиды

Кодон-оптимизированная кДНК, кодирующая шиповидный гликопротеин БВРС-КоВ [15], была синтезирована с заменой 16 аминокислот на С-конце линкером GGGGS и меткой FLAG (GenScript, Piscataway, NJ), а для эукариотической экспрессии была клонирована в pcDNA3.1(+) (Invitrogen) между сайтами BamHI и NotI . Для создания конструкций для экспрессии укороченных растворимых белков MERS S aa1-351, S aa1-384 и S aa1-748 проводили реакции ПЦР с использованием одного и того же прямого праймера AATGAAAAGCTTCACCATGATTCACTCCGTGTTCCTC в сочетании со следующими обратными праймерами для S aa1-351:

.

TAGTTTTTCTAGAACTTCCGCCTCCACCATAA

CTACAGTGGAGCTGGCT; для S аа1-384:

ТАГТТТТТАГААКТЦКГЦКТССАС

CGTCGCACTCCACGCCTTCTGCC; или для S aa1-748 TAGTTTTTCTAGAACTTC CGCCTCCACCTGGGGTCAGTGTGCTGGGGGT и клонировали в p3xFLAG-CMV 14 (Sigma, Сент-Луис, Миссури) между сайтами HindIII и XbaI для экспрессии.Плазмида VSV-g и плазмида для упаковки лентивирусов, psPAX2, были получены от Addgene (Кембридж, Массачусетс). Лентивирусная репортерная плазмида, pLenti-GFP-Luc, экспрессирующая зеленый флуоресцентный белок (GFP) и люциферазу, была любезно предоставлена ​​Fang Li, Duke University [68]

.

Клеточные линии

Линия Vero E6 клеток почек африканской зеленой мартышки, линия 293T эмбриональных клеток почек человека, трансформированных большим Т-антигеном SV40, линия Calu 3 эпителиальных клеток дыхательных путей человека, линия A549 альвеолярных эпителиальных клеток человека и легкое TB1Lu клеточная линия от Т.brasiliensis летучих мышей были получены от ATCC (Манассас, Вирджиния). Клетки Hela, стабильно экспрессирующие рекомбинантные белки CEACAM человека, и контрольная клеточная линия Hela, содержащая пустой вектор, были любезно предоставлены Scott Gray-Owen, University of Toronto [69]. Клетки EFF летучих мышей получали путем мацерации плодов летучих мышей Eptesicus fuscus в середине беременности, кратковременной обработки трипсином клеток и посева их на чашки для размножения. Клетки дважды пассировали, замораживали и любезно предоставили Ричард Боуэн, Университет штата Колорадо.Выделение клеток EFF проводили в соответствии с одобрением 03-096A Колорадского государственного университета IACUC. Ранее были описаны мышиные клетки NIh4T3, стабильно экспрессирующие рекомбинантную человеческую аминопептидазу N (hAPN), или контрольные клетки с пустым вектором [70]. Эти клеточные линии поддерживали в MEM Дульбекко с 10% фетальной бычьей сывороткой (FBS) и 2% пенициллином, стрептомицином и фугизоном (PSF) (Life Technologies Inc, Гранд-Айленд, Нью-Йорк). Линию клеток почек макаки-резус LLC-MK2 из ATCC CCL-7 поддерживали в среде Opti-MEM1 (Life Technologies Inc, Гранд-Айленд, Нью-Йорк) с 10% FBS и 2% PSF.

Производство псевдовирионов MERS и проникновение вируса, опосредованное шипами

Псевдотипированные лентивирусы были получены, как описано ранее [71] с небольшими модификациями. Вкратце, плазмиды, которые кодируют гликопротеины вирусных шипов MERS-CoV S∆16, SARS S∆19 или VSV-g, котрансфицировали в клетки 293T с psPAX2 и pLenti-GFP-Luc с использованием полиэфиримида (PEI) (Polyscience Inc, Warrington, ПА). Через 40–60 ч надосадочную среду, содержащую псевдовирионы, центрифугировали при 800 g в течение 5 мин для удаления дебриса и пропускали через 0.Фильтр 45 мкм. Для количественной оценки проникновения псевдовирионов в различные типы клеток 250 мкл псевдовирионов с 8 мкг/мл полибрена (Sigma) инокулировали на клетки в 24-луночные планшеты, инкубировали в течение ночи при 37°C и питали клетки свежей средой. Через 40 часов после инокуляции (pi) клетки лизировали при комнатной температуре 120 мкл среды с равным объемом Steady-glo (Promega, Madison, WI). Эффективность трансдукции контролировали путем количественного определения активности люциферазы. Живые клетки, трансдуцированные псевдовирионами, обнаруживали по экспрессии GFP.Для всех экспериментов были проанализированы три образца, данные репрезентативны для двух или более экспериментов, и показана стандартная ошибка.

Обнаружение вирусных гликопротеинов в псевдовирионах

псевдовириона с гликопротеином MERS-CoV SΔ16, SARS SΔ19 или VSV-g или контрольные псевдовирионы без шипа центрифугировали через 20%-ную подушку из сахарозы при 30 000 об/мин при 4°C в течение 3 ч в роторе Beckman SW41 [71]. Белки спайков в вирионах разделяли на 4-15% SDS PAGE, блотировали на нитроцеллюлозу и определяли с помощью мышиного антитела против FLAG M2 (Sigma, Сент-Луис, Миссури) для MERS-CoV SΔ16 или поликлонального козьего антитела AO4 для очищенных спайков из разрушенные детергентом вирионы MHV-59 [72], затем конъюгированные с пероксидазой хрена (HRP) антитела к IgG мыши или козы и визуализированные с помощью хемилюминесцентного реагента Plus (PerkinElmer, Бостон, Массачусетс).

Ингибирование проникновения псевдовирионов лизосомотропными агентами

Клетки

Vero E6 или LLCMK2 инкубировали в течение 1 часа при 37°C только со средой или со средой, содержащей либо 20 мМ NH 4 Cl, либо 200 нМ бафиломицина А для ингибирования подкисления эндосом, а затем инокулировали псевдовирионами и без контрольных шипов в присутствие либо 20 мМ NH 4 Cl, либо 200 нМ бафиломицина А в течение 90 мин при 1200 г при 4°C. Через 40 ч клетки pi лизировали и количественно определяли активность люциферазы как меру проникновения вируса.На рисунке 3 люциферазная активность клеток Vero E6, трансдуцированных псевдовирионами VSV-, SARS- и MERS-CoVS без ингибитора эндоцитоза, составила 1×10 6 , 1,5-2×10 6 и 5-6×10 5 соответственно. .

Влияние трипсина на проникновение псевдовирионов, адсорбированных на клеточных мембранах

Монослои клеток Vero E6 или LLCMK2 инкубировали с 20 мМ NH 4 Cl в среде, содержащей 10 % FBS, в течение 1 часа при 37 °C, затем на 15 минут повышали температуру до 4 °C с 40 мМ NH 4 Cl.Псевдовирионы адсорбировали на клетках при 4°С путем центрифугирования в течение 90 мин при 1200 g. Инокулят вируса удаляли и заменяли предварительно нагретой бессывороточной DMEM с 20 мМ NH 4 Cl или без него. Через 15 мин при 37°C среду заменяли на DMEM без сыворотки с 15 мкг/мл TPCK-трипсина или без него при комнатной температуре, чтобы активировать активность белка S по слиянию мембран на вирионах, адсорбированных на плазматической мембране. Затем активность трипсина подавляли инкубацией в течение 15 минут на льду с 75 мкг/мл ингибитора трипсина сои (Worthington Biochemical Corporation, Lakewood, NJ) в среде DMEM с 10% FBS, и клетки инкубировали в течение ночи при 37°C, питая свежей средой. и инкубировали при 37°С.Через 40 ч pi проникновение вируса количественно оценивали по активности люциферазы, и клетки фотографировали для выявления вирусных цитопатических эффектов.

Эффекты ингибиторов катепсина при проникновении псевдовирионов MERS

Монослои клеток Vero E6 или LLCMK2 предварительно инкубировали в течение 2 часов при 37°C либо с 30 мкМ E64D, который ингибирует катепсин B, H, L и кальпаин, либо с 10 мкМ специфического ингибитора катепсина L III (Millipore, Billerica, Массачусетс). Псевдовирионы и контроли без шипов с ингибиторами катепсина или без них инокулировали центрифугированием на клетки при 4°С, затем инкубировали при 37°С в течение 5 часов с ингибиторами эндоцитоза или без них.Затем клетки инкубировали при 37°C без ингибиторов, и через 40 ч pi определяли активность люциферазы в лизированных клетках.

БВРС-КоВ S∆16-опосредованное образование синцитиев

клетки 293T в 6-луночных планшетах трансфицировали с использованием PEI с 3 мкг либо пустого вектора, либо плазмиды MERS-CoV S∆16. Для кратковременной предварительной обработки трипсином клетки поднимали с помощью 1 мМ ЭДТА в PBS и промывали, затем инкубировали на льду с 20 мкг/мл трипсина TPCK или контрольной средой в течение 20 мин. Затем активность типсина подавляли инкубацией с пятикратным избытком соевого ингибитора трипсина в течение 15 мин.Предварительно обработанные трипсином клетки 293T и контрольные клетки затем наслаивали на монослои клеток Vero E6 и инкубировали в течение 20 часов. Образование синцитиев выявляли с помощью фазово-контрастной микроскопии или путем визуализации фиксированных клеток, окрашенных кристаллическим фиолетовым.

Ближневосточный респираторный синдром | NEJM

  • 1. Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus ADME, Fouchier RAM. Выделение нового коронавируса от мужчины с пневмонией в Саудовской Аравии. N Engl J Med 2012;367:1814-1820

  • 2. Всемирная организация здравоохранения. Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ) (http://www.who.int/emergencies/mers-cov/en/).

  • 3. Faure E, Poissy J, Goffard A, et al. Отчетливый иммунный ответ у двух пациентов, инфицированных БВРС-КоВ: можем ли мы перейти от скамьи к постели? PLoS One 2014;9:e88716-e88716

  • 4. Falzarano D, de Wit E, Rasmussen AL, et al. Лечение интерфероном-α2b и рибавирином улучшает исход у макак-резусов, инфицированных MERS-CoV.Nat Med 2013;19:1313-1317

  • 5. Azhar EI, El-Kafrawy SA, Farraj SA, et al. Доказательства передачи коронавируса MERS от верблюда человеку. N Engl J Med 2014;370:2499-2505

  • 6. Alraddadi BM, Watson JT, Almarashi A, et al. Факторы риска для первичного ближневосточного респираторного синдрома коронавирусной болезни у людей, Саудовская Аравия, 2014. Emerg Infect Dis 2016;22:49-55

  • 7. Müller MA, Meyer B, Corman VM, et al.Наличие антител к коронавирусу ближневосточного респираторного синдрома в Саудовской Аравии: общенациональное перекрестное серологическое исследование. Lancet Infect Dis 2015;15:559-564

  • 8. Мемиш З.А., Зумла А.И., Аль-Хаким Р.Ф., Аль-Рабиа А.А., Стивенс Г.М. Семейный кластер коронавирусных инфекций ближневосточного респираторного синдрома. N Engl J Med 2013;368:2487-2494

  • 9. Drosten C, Meyer B, Müller MA, et al. Передача MERS-коронавируса при бытовых контактах.N Engl J Med 2014;371:828-835

  • 10. Arwady MA, Alraddadi B, Basler C, et al. Передача коронавируса ближневосточного респираторного синдрома в расширенной семье, Саудовская Аравия, 2014 г. Emerg Infect Dis 2016;22:1395-1402

  • 11. Kraaij-Dirkzwager M, Timen A, Dirksen K, et al. Инфицирование коронавирусом ближневосточного респираторного синдрома (БВРС-КоВ) у двух вернувшихся путешественников в Нидерланды, май 2014 г. Euro Surveill 2014;19:20817-20817

  • 12. Обохо И.К., Томчик С.М., Аль-Асмари А.М. и др. Вспышка БВРС-КоВ в Джидде в 2014 г. — связь с медицинскими учреждениями. N Engl J Med 2015;372:846-854

  • 13. Al-Gethamy M, Corman VM, Hussain R, Al-Tawfiq JA, Drosten C, Memish ZA. Случай длительного выделения и субклинической инфекции коронавирусом ближневосточного респираторного синдрома у медицинского работника. Clin Infect Dis 2015;60:973-974

  • 14. Ki M. Вспышка MERS в Корее в 2015 г.: передача от больницы к больнице.Epidemiol Health 2015;37:e2015033-e2015033

  • 15. Al-Abdallat MM, Payne DC, Alqasrawi S, et al. Внутрибольничная вспышка коронавируса ближневосточного респираторного синдрома: серологическое, эпидемиологическое и клиническое описание. Clin Infect Dis 2014;59:1225-1233

  • 16. Balkhy HH, Alenazi TH, Alshamrani MM, et al. Описание госпитальной вспышки ближневосточного респираторного синдрома в крупной больнице третичного уровня в Саудовской Аравии.Infect Control Hosp Epidemiol 2016;37:1147-1155

  • 17. Корейский центр по контролю и профилактике заболеваний. Исправление к «Вспышка коронавируса ближневосточного респираторного синдрома в Республике Корея, 2015 г.» [Том 6, выпуск 4, август 2015 г., стр. 269-278]. Osong Public Health Res Perspect 2016;7:138-138

  • 18. Всемирная организация здравоохранения. Профилактика и контроль инфекций при оказании медицинской помощи вероятным или подтвержденным случаям заражения коронавирусом ближневосточного респираторного синдрома (БВРС-КоВ).4 июня 2015 г. (http://apps.who.int/iris/bitstream/10665/174652/1/WHO_MERS_IPC_15.1_eng.pdf?ua=1).

  • 19. Bin SY, Heo JY, Song MS, et al. Загрязнение окружающей среды и выделение вируса у пациентов с БВРС во время вспышки БВРС-КоВ в Южной Корее. Clin Infect Dis 2016;62:755-760

  • 20. Kim SH, Chang SY, Sung M, et al. Обширное заражение коронавирусом жизнеспособного ближневосточного респираторного синдрома (БВРС) в воздухе и окружающей среде в изоляторах БВРС.Clin Infect Dis 2016;63:363-369

  • 21. Schneider E, Chommanard C, Rudd J, Whitaker B, Lowe L, Gerber SI. Оценка пациентов, проходящих обследование на инфекцию БВРС-КоВ, США, январь 2013 г. – октябрь 2014 г. Emerg Infect Dis 2015;21:1220-1223

  • 22. Аль-Тауфик Дж.А., Омрани А.С., Мемиш З.А. Коронавирус ближневосточного респираторного синдрома: текущая ситуация и проблемы, связанные с поездками. Front Med 2016;10:111-119

  • 23. Верблюд второй год отсутствует на сцене хаджа. Аль-Рияд. 5 сентября 2016 г. (http://www.alriyadh.com/1531133).

  • 24. Мемиш З.А., Аль-Тауфик Дж.А., Ассири А. и др. Ближневосточный респираторный синдром коронавирусной болезни у детей. Pediatr Infect Dis J 2014;33:904-906

  • 25. de Groot RJ, Baker SC, Baric RS, et al. Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ): объявление Группы по изучению коронавируса.J Virol 2013;87:7790-7792

  • 26. van Boheemen S, de Graaf M, Lauber C, et al. Геномная характеристика недавно открытого коронавируса, связанного с острым респираторным дистресс-синдромом у людей. MBio 2012;3(6):e00473-12-e00473-12

  • 27. Smith EC, Blanc H, Surdel MC, Vignuzzi M, Denison MR. Коронавирусы, не обладающие экзорибонуклеазной активностью, подвержены летальному мутагенезу: доказательства для корректировки и потенциальных терапевтических средств.PLoS Pathog 2013;9:e1003565-e1003565

  • 28. Chan CM, Chu H, Wang Y, et al. Молекула клеточной адгезии 5, связанная с карциноэмбриональным антигеном, является важным фактором поверхностного прикрепления, который облегчает проникновение коронавируса ближневосточного респираторного синдрома. J Virol 2016;90:9114-9127

  • 29. Gierer S, Bertram S, Kaup F, et al. Спайковый белок нового бета-коронавируса EMC использует новый рецептор коронавируса для входа, может быть активирован TMPRSS2 и нацелен на нейтрализующие антитела.J Virol 2013;87:5502-5511

  • 30. Миллет Дж.К., Уиттакер Г.Р. Проникновение в клетки-хозяева коронавируса ближневосточного респираторного синдрома после двухступенчатой ​​фурин-опосредованной активации шиповидного белка. Proc Natl Acad Sci U S A 2014;111:15214-15219

  • 31. Muth D, Corman VM, Meyer B, et al. Экскреция коронавируса инфекционного ближневосточного респираторного синдрома и вариабельность серотипа на основе живых изолятов вируса от пациентов в Саудовской Аравии.J Clin Microbiol 2015;53:2951-2955

  • 32. Jiang L, Wang N, Zuo T, et al. Мощная нейтрализация БВРС-КоВ человеческими нейтрализующими моноклональными антителами к гликопротеину вирусного шипа. Sci Transl Med 2014;6:234ra59-234ra59

  • 33. Tang XC, Agnihothram SS, Jiao Y, et al. Идентификация человеческих нейтрализующих антител против БВРС-КоВ и их роль в адаптивной эволюции вируса. Proc Natl Acad Sci U S A 2014;111:E2018-E2026

  • 34. Консорциум FANTOM и RIKEN PMI и CLST (DGT). Атлас экспрессии млекопитающих на уровне промотора. Nature 2014;507:462-470

  • 35. Chan JF, Chan KH, Choi GK, et al. Дифференциальная восприимчивость клеточных линий к появляющемуся новому бета-коронавирусу человека 2c EMC/2012: последствия для патогенеза заболевания и клинических проявлений. J Infect Dis 2013;207:1743-1752

  • 36. Hocke AC, Becher A, Knepper J, et al. Возникающий коронавирус ближневосточного респираторного синдрома человека вызывает широко распространенную инфекцию и альвеолярное повреждение легких человека.Am J Respir Crit Care Med 2013;188:882-886

  • 37. de Wit E, Rasmussen AL, Falzarano D, et al. Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ) вызывает преходящую инфекцию нижних дыхательных путей у макак-резусов. Proc Natl Acad Sci U S A 2013;110:16598-16603

  • 38. Falzarano D, de Wit E, Feldmann F, et al. Заражение MERS-CoV вызывает летальную пневмонию у обыкновенной мартышки. PLoS Pathog 2014;10:e1004250-e1004250

  • 39. Корман В.М., Альбаррак А.М., Омрани А.С. и др. Выделение вируса и ответ антител у 37 пациентов с коронавирусной инфекцией ближневосточного респираторного синдрома. Clin Infect Dis 2016;62:477-483

  • 40. Мемиш З.А., Ассири А.М., Аль-Тауфик Дж.А. Выделение вируса коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) в дыхательных путях: наблюдательный анализ с последствиями инфекционного контроля. Int J Infect Dis 2014;29:307-308

  • 41. Ким С.Ю., Пак С.Дж., Чо С.Ю. и др. Вирусная РНК в крови как показатель тяжелого исхода коронавирусной инфекции ближневосточного респираторного синдрома. Emerg Infect Dis 2016;22:1813-1816

  • 42. Shalhoub S, Farahat F, Al-Jiffri A, et al. IFN-α2a или IFN-β1a в комбинации с рибавирином для лечения коронавирусной пневмонии с ближневосточным респираторным синдромом: ретроспективное исследование. J Antimicrob Chemother 2015;70:2129-2132

  • 43. van Doremalen N, Miazgowicz KL, Milne-Price S, et al.Ограничение вида-хозяина коронавируса ближневосточного респираторного синдрома через его рецептор, дипептидилпептидазу 4. J Virol 2014;88:9220-9232

  • 44. Zhao J, Li K, Wohlford-Lenane C, et al. Быстрое создание мышиной модели ближневосточного респираторного синдрома. Proc Natl Acad Sci U S A 2014;111:4970-4975

  • 45. Agrawal AS, Garron T, Tao X, et al. Создание трансгенной мышиной модели коронавирусной инфекции и заболевания ближневосточного респираторного синдрома.J Virol 2015;89:3659-3670

  • 46. Munster VJ, de Wit E, Feldmann H. Пневмония от коронавируса человека на модели макаки. N Engl J Med 2013;368:1560-1562

  • 47. Chan JF, Yao Y, Yeung ML, et al. Лечение лопинавиром/ритонавиром или интерфероном-β1b улучшает исход инфекции MERS-CoV в модели обыкновенной мартышки на нечеловекообразных приматах. J Infect Dis 2015;212:1904-1913

  • 48. Johnson RF, Via LE, Kumar MR, et al.Внутритрахеальное воздействие изолятов MERS-CoV Jordan-n3/2012 или MERS-CoV EMC/2012 на обыкновенных мартышек не приводит к летальному исходу. Virology 2015;485:422-430

  • 49. Ng DL, Al Hosani F, Keating MK, et al. Клинико-патологические, иммуногистохимические и ультраструктурные данные смертельного случая коронавирусной инфекции ближневосточного респираторного синдрома в Объединенных Арабских Эмиратах, апрель 2014 г. Am J Pathol 2016; , Baez-Santos YM, Mesecar AD, Baker SC.Папаиноподобная протеаза БВРС-КоВ обладает деИСГилирующей и деубиквитинирующей активностью. Virology 2014;450-451:64-70

  • 51. Lokugamage KG, Narayanan K, Nakagawa K, et al. Коронавирус ближневосточного респираторного синдрома nsp1 ингибирует экспрессию генов-хозяев, избирательно воздействуя на транскрибируемые в ядре мРНК, но не затрагивая мРНК цитоплазматического происхождения. J Virol 2015;89:10970-10981

  • 52. Yang Y, Zhang L, Geng H, et al. Структурные и вспомогательные белки M, ORF 4a, ORF 4b и ORF 5 коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) являются мощными антагонистами интерферона.Protein Cell 2013;4:951-961

  • 53. Liu DX, Fung TS, Chong KK, Shukla A, Hilgenfeld R. Дополнительные белки SARS-CoV и других коронавирусов. Antiviral Res 2014;109:97-109

  • 54. Josset L, Menachery VD, Gralinski LE, et al. Реакция клетки-хозяина на заражение новым человеческим коронавирусом EMC прогнозирует потенциальные противовирусные препараты и важные отличия от коронавируса SARS. MBio 2013;4:e00165-e13

  • 55. Park WB, Perera RA, Choe PG, et al. Кинетика серологических реакций на коронавирусную инфекцию MERS у людей, Южная Корея. Emerg Infect Dis 2015;21:2186-2189

  • 56. Min CK, Cheon S, Ha NY, et al. Сравнительный и кинетический анализ выделения вируса и иммунологических ответов у пациентов с MERS, представляющих широкий спектр тяжести заболевания. Sci Rep 2016;6:25359-25359

  • 57. Arabi YM, Hajeer AH, Luke T, et al. Возможность использования иммунотерапии реконвалесцентной плазмой при инфекции MERS-CoV, Саудовская Аравия.Emerg Infect Dis 2016;22:1554-1561

  • 58. Араби Ю.М., Арифи А.А., Балхи Х.Х., и соавт. Клиническое течение и исходы у больных в критическом состоянии с коронавирусной инфекцией ближневосточного респираторного синдрома. Ann Intern Med 2014;160:389-397

  • 59. Payne DC, Iblan I, Alqasrawi S, et al. Мертворождение при заражении коронавирусом ближневосточного респираторного синдрома. J Infect Dis 2014;209:1870-1872

  • 60. Arabi YM, Harthi A, Hussein J, et al.Тяжелый неврологический синдром, связанный с коронавирусом ближневосточного респираторного синдрома (БВРС-КоВ). Инфекция 2015;43:495-501

  • 61. Всемирная организация здравоохранения. Надзор за заражением человека коронавирусом ближневосточного респираторного синдрома (БВРС-КоВ): временное руководство. 30 июня 2015 г. (http://www.who.int/csr/disease/coronavirus_infections/surveillance-human-infection-mers/en/).

  • 62. Мемиш З.А., Аль-Тауфик Дж.А., штаб-квартира Махдум, и др.Образцы дыхательных путей, вирусная нагрузка и выход фракций генома у пациентов с ближневосточным респираторным синдромом. J Infect Dis 2014;210:1590-1594

  • 63. Исследовательская группа ВОЗ Mers-Cov. Состояние знаний и пробелы в данных о коронавирусе ближневосточного респираторного синдрома (БВРС-КоВ) у людей. PLoS Curr 2013;5

  • 64. Corman VM, Müller MA, Costabel U, et al. Анализы для лабораторного подтверждения инфекций, вызванных новым коронавирусом человека (hCoV-EMC).Евронадзор 2012;17(49):20334.

  • 65. Corman VM, Eckerle I, Bleicker T, et al. Обнаружение нового коронавируса человека с помощью полимеразной цепной реакции с обратной транскрипцией в реальном времени. Euro Surveill 2012;17:20285-20285

  • 66. Drosten C, Muth D, Corman VM, et al. Обсервационное лабораторное исследование вспышек коронавируса ближневосточного респираторного синдрома в Джидде и Эр-Рияде, Королевство Саудовская Аравия, 2014 г. Clin Infect Dis 2015;60:369-377

  • 67. Омрани А.С., Саад М.М., Байг К. и др. Рибавирин и интерферон альфа-2а при тяжелой коронавирусной инфекции ближневосточного респираторного синдрома: ретроспективное когортное исследование. Lancet Infect Dis 2014;14:1090-1095

  • 68. Mair-Jenkins J, Saavedra-Campos M, Baillie JK, et al. Эффективность реконвалесцентной плазмы и гипериммунного иммуноглобулина для лечения тяжелых острых респираторных инфекций вирусной этиологии: систематический обзор и поисковый метаанализ.J Infect Dis 2015;211:80-90

  • 69. Auyeung TW, Lee JS, Lai WK, et al. Использование кортикостероидов в качестве лечения атипичной пневмонии было связано с неблагоприятными исходами: ретроспективное когортное исследование. J Infect 2005;51:98-102

  • 70. Chan JF, Chan KH, Kao RY, et al. Противовирусные препараты широкого спектра действия для нового коронавируса ближневосточного респираторного синдрома. J Infect 2013;67:606-616

  • 71. Zumla A, Azhar EI, Arabi Y, et al.Терапия, направленная на хозяина, для улучшения неблагоприятных результатов лечения, связанных с коронавирусными инфекциями ближневосточного респираторного синдрома. Int J Infect Dis 2015;40:71-74

  • 72. Agrawal AS, Tao X, Algaissi A, et al. Иммунизация инактивированной вакциной против коронавируса ближневосточного респираторного синдрома приводит к иммунопатологии легких при заражении живым вирусом. Hum Vaccin Immunother 2016;12:2351-2356

  • 73. Dunning JW, Merson L, Rohde GG, et al.Клиническая наука с открытым исходным кодом для новых инфекций. Lancet Infect Dis 2014;14:8-9

  • 74. Van Kerkhove MD, Broberg E, Engelhardt OG, Wood J, Nicoll A. Консорциум по стандартизации сероэпидемиологии гриппа (CONSISE): глобальное партнерство для стандартизировать сероэпидемиологию гриппа и разработать протоколы расследования гриппа для информирования политики общественного здравоохранения. Influenza Other Respir Viruses 2013;7:231-234

  • Паспорт безопасности патогенов: Инфекционные вещества – Коронавирус, связанный с ближневосточным респираторным синдромом (MERS)

    Сноска 1

    Заки, А.M., Van Boheemen, S., Bestebroer, T.M., Osterhaus, A.D.M.E., and Fouchier, R.A.M. (2012) Выделение нового коронавируса у мужчины с пневмонией в Саудовской Аравии . Новый английский J.Med. 367, 1814-1820

    Вернуться к сноске 1

    Сноска 2

    Фер, А.Р., Чаннаппанавар, Р., и Перлман, С. (2017) Ближневосточный респираторный синдром: появление патогенного человеческого коронавируса . Анну. преподобный мед. 68, 387-399

    Вернуться к сноске 2

    Сноска 3

    Агентство по охране здоровья (HPA) Британская группа по расследованию новых коронавирусов (2013 г.) Доказательства передачи от человека к человеку в рамках семейного кластера новых коронавирусных инфекций, Великобритания, февраль 2013 г. Euro Surveill. 18, 20427

    Вернуться к сноске 3

    Сноска 4

    Коттен, М., Уотсон, С.Дж., Зумла, А.И., Махдум, штаб-квартира, Палсер, А.Л., Онг, С.Х., Аль-Рабиах, А.А., Алхаким, РФ, Ассири, А., Аль-Тауфик, Дж.А., Альбаррак, А., Барри, М. , Шибл А., Альрабиа Ф.А., Хаджар С., Балхи Х.Х., Флембан Х., Рамбо А., Келлам П. и Мемиш З.А. (2014) Распространение, циркуляция и эволюция коронавируса ближневосточного респираторного синдрома. МБио. 5, 10.1128/мБио.01062-13

    Вернуться к сноске 4

    Сноска 5

    Зумла, А., Хуэй, Д.С., и Перлман, С. (2015) Ближневосточный респираторный синдром . Ланцет. 386, 995-1007

    Вернуться к сноске 5

    Сноска 6

    Араби, Ю.М., Арифи, А.А., Балхи, Х.Х., Наджм, Х., Алдавуд, А.С., Габаши, А., Хава, Х., Алотман, А., Халди, А., и Аль Рай, Б. (2014 г. ) Клиническое течение и исходы у тяжелобольных с коронавирусной инфекцией ближневосточного респираторного синдрома .Энн.Интерн.Мед. 160, 389-397

    Вернуться к сноске 6

    Сноска 7

    Всемирная организация здравоохранения (2017 г.) Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ)

    Вернуться к сноске 7

    Сноска 8

    Адни, Д.Р., ван Доремален, Н., Браун, В.Р., Бушмейкер, Т., Скотт, Д., де Вит, Э., Боуэн, Р.А., и Мюнстер, В.Дж. (2014) Репликация и выделение MERS-CoV в верхних дыхательных путях инокулированных верблюдов-верблюдов .Emerg.Infect.Dis. 20, 1999-2005

    Вернуться к сноске 8

    Сноска 9

    де Вит, Э., Расмуссен, А.Л., Фальзарано, Д., Бушмейкер, Т., Фельдманн, Ф., Брининг, Д.Л., Фишер, Э.Р., Мартелларо, К., Окумура, А., Чанг, Дж., Скотт , Д., Бенеке, А.Г., Катце, М.Г., Фельдманн, Х., и Мюнстер, В.Дж. (2013) Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ) вызывает преходящую инфекцию нижних дыхательных путей у макак-резусов .Proc.Natl.Acad.Sci.U.S.A. 110, 16598-16603

    Вернуться к сноске 9

    Сноска 10

    Яо, Ю., Бао, Л., Дэн, В., Сюй, Л., Ли, Ф., Лев, К., Ю, П., Чен, Т., Сюй, Ю. и Чжу, Х. (2013) Животная модель MERS, полученная путем заражения макак-резусов коронавирусом MERS . J.Infect.Дис. 209, 236-242

    Вернуться к сноске 10

    Сноска 11

    Фальзарано, Д., де Вит, Э., Фельдманн, Ф., Расмуссен, А.Л., Окумура, А., Пэн, X., Томас, М.Дж., ван Доремален, Н., Хэддок, Э., и Наги, Л. (2014) Инфекция с MERS-CoV вызывает смертельную пневмонию у обыкновенной мартышки . Возбудители PLoS. 10, е1004250

    Вернуться к сноске 11

    Сноска 12

    Альхамлан, Ф.С., Маджумдер, М.С., Браунштейн, Дж.С., Хокинс, Дж., Аль-Абдели, Х.М., Альзахрани, А., Обейд, Д.А., Аль-Ахдал, М.Н. и БинСаид А. (2017) Характеристика случаев вспышки коронавируса ближневосточного респираторного синдрома и не вспышек в Саудовской Аравии с 2012 по 2015 год . Открытый БМЖ. 7, e011865-2016-011865

    Вернуться к сноске 12

    Сноска 13

    Госснер, К., Даниэльсон, Н., Гервельмейер, А., Берта, Ф., Фэй, Б., Каасик Ааслав, К., Адлхох, К., Зеллер, Х., Пенттинен, П., и Куломбье, D. (2016) Взаимодействия человека и одногорбого верблюда и риск заражения коронавирусной инфекцией зоонозного ближневосточного респираторного синдрома .Зоонозы и общественное здоровье. 63, 1-9

    Вернуться к сноске 13

    Сноска 14

    Ван Доремален, Н., Бушмейкер, Т., и Манстер, В. (2013) Стабильность коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) в различных условиях окружающей среды . Евронаблюдение. 18, 20590

    Вернуться к сноске 14

    Сноска 15

    Ассири, А., МакГир, А., Перл, Т.М., Прайс, К.С., Аль-Рабиах, А.А., Каммингс, Д.А.Т., Алабдуллатиф, З.Н., Асад, М., Альмульхим, А., Махдум, Х., Мадани, Х., Альхаким, Р. ., Аль-Тауфик, Дж. А., Коттен, М., Уотсон, С. Дж., Келлам, П., Зумла, А. И. и Мемиш, З. А. (2013) Вспышка в больнице ближневосточного респираторного синдрома, коронавирус . Новый английский J.Med. 369, 407-416

    Вернуться к сноске 15

    Сноска 16

    Радж, В.С., Остерхаус, А.Д., Фушье, Р.А., и Хаагманс, Б.Л. (2014) MERS: появление нового человеческого коронавируса . Современное мнение в вирусологии. 5, 58-62

    Вернуться к сноске 16

    Сноска 17

    Мюллер, М.А., Мейер, Б., Корман, В.М., Аль-Масри, М., Туркестани, А., Ритц, Д., Зиберг, А., Алдаббаг, С., Бош, Б., и Латтвайн, Э. (2015) Наличие антител к коронавирусу ближневосточного респираторного синдрома в Саудовской Аравии: общенациональное перекрестное серологическое исследование .Ланцет Инфекционные заболевания. 15, 559-564

    Вернуться к сноске 17

    Сноска 18

    Адни, Д.Р., Билефельдт-Оманн, Х., Хартвиг, А.Е., и Боуэн, Р.А. (2016) Заражение, репликация и передача коронавируса ближневосточного респираторного синдрома у альпак . Emerg.Infect.Dis. 22, 1031-1037

    Вернуться к сноске 18

    Сноска 19

    Пибоди, Р.Г., Чанд, М.А., Томас, Х.Л., Грин, Х.К., Боддингтон, Н.Л., Карвалью, К., Браун, К.С., Андерсон, С.Р., Руни, К., Кроули-Боеви, Э., Ирвин, Д.Дж., Ааронс, Э., Тонг К., Ньюсхолм В., Прайс Н., Лэнгриш К., Такер Д., Чжао Х., Фин Н., Крофтс Дж., Бермингем А., Гилганн- Jones, E., Brown, KE, Evans, B., Catchpole, M., and Watson, JM (2012) Реагирование общественного здравоохранения Соединенного Королевства на импортированный лабораторно подтвержденный случай нового коронавируса в сентябре 2012 года. Euro Surveill. 17, 20292

    Вернуться к сноске 19

    Сноска 20

    Моджаррад, К.(2016) Кандидаты на вакцину MERS-CoV в разработке: Текущая ситуация . вакцина. 34, 2982-2987

    Вернуться к сноске 20

    Сноска 21

    Мохд, Х.А., Аль-Тауфик, Дж.А., и Мемиш, З.А. (2016) Происхождение коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) и резервуар животных . Вирусологический журнал. 13, 87

    Вернуться к сноске 21

    Сноска 22

    Хемида, М., Эльмослемани, А., Аль-Хизаб, Ф., Алнаим, А., Алматен, Ф., Фэй, Б., Чу, Д., Перера, Р., и Пейрис, М. (2017) Верблюды-дромадеры и передача коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) . Трансграничные и возникающие болезни. 64, 344-353

    Вернуться к сноске 22

    Сноска 23

    Перера Р.А., Ван П., Гомаа М.Р., Эль-Шешени Р., Кандейл А., Багато О., Сиу Л.Ю., Шехата М.M., Kayed, AS, Moatasim, Y., Li, M., Poon, LL, Guan, Y., Webby, RJ, Ali, MA, Peiris, JS, и Kayali, G. (2013) Сероэпидемиология коронавируса MERS с использованием анализов микронейтрализации и нейтрализации псевдочастиц вируса выявлена ​​высокая распространенность антител у одногорбых верблюдов в Египте, июнь 2013 г. . Евронаблюдение. 18

    Вернуться к сноске 23

    Сноска 24

    Реускен, К.Б., Шилп, К., Радж В.С., Де Брюин Э., Коль Р.Х., Фараг Э.А., Хаагманс Б.Л., Аль-Ромаихи Х., Ле Гранж Ф., Бош Б.Дж. и Купманс М.П. (2016) Заражение БВРС-КоВ альпаки в регионе, где БВРС-КоВ является эндемичным . Emerg.Infect.Dis. 22, 1129-1131

    Вернуться к сноске 24

    Сноска 25

    Чжао, Дж., Ли, К., Вулфорд-Ленане, К., Агнихотрам, С.С., Фетт, К., Чжао, Дж., Гейл, М.Дж., младший, Барик, Р.С., Энхуанес, Л., Галлахер, Т., Маккрей, П.Б., младший, и Перлман, С. (2014) Быстрое создание мышиной модели ближневосточного респираторного синдрома . Proc.Natl.Acad.Sci.U.S.A. 111, 4970-4975

    Вернуться к сноске 25

    Сноска 26

    Ли, К., Вулфорд-Ленане, К., Перлман, С., Чжао, Дж., Джуэлл, А.К., Резников, Л.Р., Гибсон-Корли, К.Н., Мейерхольц, Д.К., и Маккрей младший, П.Б. (2015) Коронавирус ближневосточного респираторного синдрома вызывает множественное поражение органов и летальное заболевание у мышей, трансгенных по дипептидилпептидазе человека 4 .J.Infect.Дис. 213, 712-722

    Вернуться к сноске 26

    Сноска 27

    Хаагманс, Б.Л., ван ден Бранд, Дж.М., Провасия, Л.Б., Радж, В.С., Ститтелар, К.Дж., Гету, С., де Ваал, Л., Бестеброер, Т.М., ван Амеронген, Г., Вержанс, Г.М., Фушье, Р.А., Смитс, С.Л., Куикен, Т., и Остерхаус, А.Д. (2015) Бессимптомная коронавирусная инфекция ближневосточного респираторного синдрома у кроликов . Дж. Вирол. 89, 6131-6135

    Вернуться к сноске 27

    Сноска 28

    Базелер, Л.Дж., Фальзарано Д., Скотт Д.П., Розенке Р., Томас Т., Мюнстер В.Дж., Фельдманн Х. и де Вит Э. (2016) Острый иммунный ответ на коронавирус ближневосточного респираторного синдрома репликация способствует вирусной патогенности . Американский журнал патологии. 186, 630-638

    Вернуться к сноске 28

    Сноска 29

    Вергара-Алерт, Дж., ван ден Бранд, Дж.М., Видагдо, В., Муньос, М.5., Радж, С., Шиппер, Д., Соланес, Д., Кордон, И., Бенсаид, А., Хаагманс, Б.Л., и Сегалес, Дж. (2017) Восприимчивость домашнего скота к заражению коронавирусом ближневосточного респираторного синдрома . Emerg.Infect.Dis. 23, 232-240

    Вернуться к сноске 29

    Сноска 30

    Тао, X., Гаррон, Т., Агравал, А.С., Алгайси, А., Пэн, Б.Х., Вакамия, М., Чан, Т.С., Лу, Л., Ду, Л., Цзян, С., Коуч, РБ и Ценг, Коннектикут (2015) Характеристика и демонстрация ценности летальной мышиной модели ближневосточного респираторного синдрома коронавирусной инфекции и заболевания .Дж. Вирол. 90, 57-67

    Вернуться к сноске 30

    Сноска 31

    Song, JY, Cheong, HJ, Choi, MJ, Jeon, JH, Kang, SH, Jeong, EJ, Yoon, JG, Lee, SN, Kim, SR, Noh, JY и Kim, WJ (2015) Выделение вируса и очистка окружающей среды при коронавирусной инфекции ближневосточного респираторного синдрома . Infect.Chemother. 47, 252-255

    Вернуться к сноске 31

    Сноска 32

    Мемиш, З.А., Ассири А.М. и Аль-Тауфик Дж.А. (2014) Выделение вируса коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) в дыхательных путях: наблюдательный анализ с последствиями инфекционного контроля . Международный журнал инфекционных заболеваний. 29, 307-308

    Вернуться к сноске 32

    Сноска 33

    Али М., Эль-Шешени Р., Кандейл А., Шехата М., Элсокари Б., Гомаа М., Хассан Н., Эль Сайед А., Эль-Тавил А., Собхи Х., Фасина Ф.О., Дофин Г., Эль Масри И., Вольде А.В., Дашак П., Миллер М., Фон Добшуец С., Морзария С. ., Lubroth, J., and Makonnen, YJ (2017) Поперечное наблюдение за коронавирусом ближневосточного респираторного синдрома (БВРС-КоВ) у одногорбых верблюдов и других млекопитающих в Египте, с августа 2015 г. по январь 2016 г. . Евронаблюдение. 22, 10.2807/1560-7917.ЧС.2017.22.11.30487

    Вернуться к сноске 33

    Сноска 34

    Араби, Ю.М., Балхи, Х. Х., Хайден, Ф. Г., Бушама, А., Люк, Т., Бейли, Дж. К., Аль-Омари, А., Хаджир, А. Х., Сенга, М., и Денисон, М. Р. (2017) Ближний Восток респираторный синдром . N.Engl.J.Med. 376, 584-594

    Вернуться к сноске 34

    Сноска 35

    Фальзарано, Д., Де Вит, Э., Расмуссен, А.Л., Фельдманн, Ф., Окумура, А., Скотт, Д.П., Брининг, Д., Бушмейкер, Т., Мартелларо, К., и Базелер, Л. (2013) Лечение интерфероном-[альфа] 2b и рибавирином улучшает исход у макак-резусов, инфицированных MERS-CoV .Нац.мед. 19, 1313-1317

    Вернуться к сноске 35

    Сноска 36

    Чан, Дж. Ф., Яо, Ю., Юнг, М., Дэн, В., Бао, Л., Цзя, Л., Ли, Ф., Сяо, К., Гао, Х. и Ю, П. (2015) Лечение лопинавиром/ритонавиром или интерфероном-β1b улучшает исход инфекции MERS-CoV в модели обыкновенной мартышки на нечеловеческих приматах . J.Infect.Дис. 212, 1904-1913

    Вернуться к сноске 36

    Сноска 37

    Шихан, Т.П., Симс, А.С., Грэм, Р.Л., Менахери, В.Д., Гралински, Л.Е., Кейс, Дж.Б., Лейст, С.Р., Пирк, К., Фенг, Дж.Ю., Транчева, И., Баннистер, Р., Парк, Ю. , Бабусис, Д., Кларк, М.О., Макман, Р.Л., Спан, Дж.Э., Пальмиотти, К.А., Сигел, Д., Рэй, А.С., Чихлар, Т., Джордан, Р., Денисон, М.Р., и Барик, Р.С. (2017) Противовирусный препарат широкого спектра действия GS-5734 ингибирует как эпидемические, так и зоонозные коронавирусы . науч. трансл. мед. 9, 10.1126/scitranslmed.aal3653

    Вернуться к сноске 37

    Сноска 38

    Лин, С., Хо, К., Чуо, В., Ли, С., Ван, Т.Т., и Лин, К. (2017) Эффективное ингибирование инфекции MERS-CoV с помощью ресвератрола . Инфекционные заболевания ВМС. 17, 144

    Вернуться к сноске 38

    Сноска 39

    Лай, М.Ю., Ченг, П.К., и Лим, В.В. (2005) Выживаемость при тяжелом остром респираторном синдроме коронавирус . Клин.Инфект.Дис. 41, е67-71

    Вернуться к сноске 39

    Сноска 40

    Рабенау, Х., Cinatl, J., Morgenstern, B., Bauer, G., Preiser, W., и Doerr, H. (2005) Стабильность и инактивация коронавируса SARS . Мед.Микробиолог.Иммунол.(Берл.). 194, 1-6

    Вернуться к сноске 40

    Сноска 41

    ван Доремален, Н. (2014) Стабильность коронавируса ближневосточного респираторного синдрома в молоке. Внезапное заражение Dis . 20, 1263-1264

    Вернуться к сноске 41

    Сноска 42

    Леклерк, И., Batéjat, C., Burguière, AM, и Manuguerra, J. (2014) Тепловая инактивация коронавируса ближневосточного респираторного синдрома . Грипп.Другие респираторные вирусы. 8, 585-586

    Вернуться к сноске 42

    Сноска 43

    Бонни Т.С., Йезли С. и Ледницки Дж.А. (2017) Выделение и идентификация коронавируса человека 229E на поверхностях, к которым часто прикасаются, в университетском классе, который ежедневно убирается .Am.J.Infect.Control. 46 , 105-107

    Вернуться к сноске 43

    Сноска 44

    Геллер К., Варбанов М. и Дюваль Р.Е. (2012) Коронавирусы человека: взгляд на устойчивость к окружающей среде и ее влияние на разработку новых антисептических стратегий . Вирусы. 4, 3044-3068

    Вернуться к сноске 44

    Сноска 45

    Оттер, Дж., Донски, К., Езли, С., Даутуэйт, С., Гольденберг, С., и Вебер, Д.Дж. (2016) Передача коронавирусов SARS и MERS и вируса гриппа в медицинских учреждениях: возможная роль загрязнения сухих поверхностей . J.Hosp.Infect. 92, 235-250

    Вернуться к сноске 45

    Сноска 46

    Моджаррад, К., Мурти, В.С., Эмбарек, П.Б., Ван Керхове, М., Ким, Дж., и Киини, М. (2016 г.) Дорожная карта для исследований и разработки продуктов MERS-CoV: отчет Всемирной организации здравоохранения консультация .Нац.мед. 22, 701-705

    Вернуться к сноске 46

    Сноска 47

    Майр-Дженкинс, Дж., Сааведра-Кампос, М., Бэйли, Дж. К., Клири, П., Хау, Ф., Лим, В. С., Макки, С., Руни, К. Д., Исследовательская группа реконвалесцентной плазмы, и Нгуен- Ван-Там, Дж. С. (2014)Эффективность реконвалесцентной плазмы и гипериммунного иммуноглобулина для лечения тяжелых острых респираторных инфекций вирусной этиологии: систематический обзор и исследовательский метаанализ .J.Infect.Дис. 211, 80-90

    Вернуться к сноске 47

    Сноска 48

    Окба, Н.М., Радж, В.С., и Хаагманс, Б.Л. (2017) Вакцины против коронавируса ближневосточного респираторного синдрома: текущее состояние и новые подходы . Curr.Opin.Virol. 23, 49-58

    Вернуться к сноске 48

    Сноска 49

    Корти, Д., Чжао, Дж., Педотти М., Симонелли Л., Агнихотрам С., Фетт К., Фернандес-Родригес Б., Фольерини М., Агатик Г., Ванцетта Ф., Гопал Р., Лангриш, CJ, Barrett, NA, Sallusto, F., Baric, RS, Varani, L., Zambon, M., Perlman, S., and Lanzavecchia, A. (2015) Профилактическая и постэкспозиционная эффективность мощного человеческого моноклонального антитела против MERS коронавирус . Proc.Natl.Acad.Sci.U.S.A. 112, 10473-10478

    Вернуться к сноске 49

    Сноска 50

    Хаузер, К.В., Гретебек Л., Ин Т., Ван Ю., Фогель Л., Ламиранд Э.В., Бок К.В., Мур И.Н., Димитров Д.С. и Суббарао К. (2016) Профилактика с помощью Человеческие моноклональные антитела, специфичные к коронавирусу ближневосточного респираторного синдрома (БВРС-КоВ), защищают кроликов от инфекции БВРС-КоВ . J.Infect.Дис. 213, 1557-1561

    Вернуться к сноске 50

    Сноска 51

    Вюрц, Н., Папа, А., Хукич, М., Ди Каро, А., Лепарк-Гоффарт, И., Лерой, Э., Ландини, М., Секеева, З., Думлер, Дж., и Бадеску, Д. (2016) Исследование лабораторных инфекций во всем мире на уровне биобезопасности 3 и 4 лаборатории . Европейский журнал клинической микробиологии и инфекционных заболеваний. 35, 1247-1258

    Вернуться к сноске 51

    Сноска 52

    Маккей, И.М., и Арден, К.Е. (2015) Ближневосточный респираторный синдром: возникающая коронавирусная инфекция, отслеживаемая толпой .Вирус Рез. 202, 60-88

    Вернуться к сноске 52

    Сноска 53

    Алагаили, А.Н., Бриз, Т., Мишра, Н., Капур, В., Самерофф, С.К., Бурбело, П.Д., де Вит, Э., Мюнстер, В.Дж., Хенсли, Л.Е., Залмут, И.С., Капур, А. , Эпштейн, Дж. Х., Кареш, В. Б., Дасзак, П., Мохаммед, О. Б., и Липкин, В. И. (2014) Коронавирусная инфекция ближневосточного респираторного синдрома у верблюдов-верблюдов в Саудовской Аравии . МБио. 5, e00884-14

    Вернуться к сноске 53

    Сноска 54

    Омрани, А.С., Аль-Тауфик, Дж.А., и Мемиш, З.А. (2015) Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ): взаимодействие животных с людьми . Патогены и глобальное здоровье. 109, 354-362

    Вернуться к сноске 54

    Сноска 55

    Правительство Канады (2016 г.) Канадское руководство по биобезопасности, 2-е издание, 2-е изд., Оттава, Канада

    Вернуться к сноске 55

    Сноска 56

    Агентство общественного здравоохранения Канады (2015 г.) Канадский стандарт биобезопасности, Второе издание, Правительство Канады, Оттава

    Вернуться к сноске 56

    Эпидемиологические характеристики и начальные клинические проявления пациентов с лабораторно подтвержденной инфекцией MERS-CoV в отделении неотложной помощи

    [1] Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus ADME, Fouchier RAM.Выделение нового коронавируса от мужчины с пневмонией в Саудовской Аравии. Медицинский журнал Новой Англии. 2012; 367: 1814–1820.

    [2] Региональное бюро Всемирной организации здравоохранения для Восточного Средиземноморья. Домашняя страница в Интернете. 2021. Доступно по адресу: http://www.emro.who.int/health-topics/mers-cov/mers-outbreaks.html (дата обращения: 1 мая 2021 г.).

    [3] Аль-Тауфик Дж.А., Мемиш З.А. Коронавирус ближневосточного респираторного синдрома: передача и филогенетическая эволюция. Тенденции микробиологии.2014. Т. 22. С. 573–579.

    [4] Аль-Тауфик Дж.А., Мемиш З.А. Ближневосточный респираторный синдром Коронавирус и тяжелый острый респираторный синдром Коронавирус. Семинары по респираторной и реаниматологической медицине. 2020. Т. 41. С. 568–578.

    [5] Всемирная организация здравоохранения. Домашняя страница в Интернете. 2021. Доступно по адресу: https://www.who.int/activities/prioritizing-diseases-for-research-and-development-in-emergency-contexts (дата обращения: 1 мая 2021 г.).

    [6] Дростен С., Мут Д., Корман В.М., Хуссейн Р., Аль Масри М., ХайОмар В. и др.Наблюдательное лабораторное исследование вспышек коронавируса ближневосточного респираторного синдрома в Джидде и Эр-Рияде, Королевство Саудовская Аравия, 2014 г. Клинические инфекционные заболевания. 2015. Т. 60. С. 369–377.

    [7] Assiri A, McGeer A, Perl TM, Price CS, Al Rabeeah AA, Cummings DAT, et al. Больничная вспышка ближневосточного респираторного синдрома Коронавирус. Медицинский журнал Новой Англии. 2013. 369: 407–416.

    [8] Мемиш З.А., Аль-Тауфик Дж.А., Алхаким Р.Ф., Ассири А., Альхарби К.Д., Алма-халлави М.С. и др.Коронавирус ближневосточного респираторного синдрома (БВРС-КоВ): кластерный анализ с последствиями для глобального ведения подозрительных случаев. Медицина путешествий и инфекционные заболевания. 2015. Т. 13. С. 311–314.

    [9] Эль-Бушра Х.Э., Абдалла М.Н., Аль-Арбаш Х., Альшайеб З., Аль-Али С., Латиф З.А. и др. Вспышка ближневосточного респираторного синдрома (БВРС) из-за коронавируса в регионе Аль-Ахса, Саудовская Аравия, 2015 г. Журнал здравоохранения Восточного Средиземноморья. 2016. Т. 22. С. 468–475.

    [10] Balkhy HH, Alenazi TH, Alshamrani MM, Baffoe-Bonnie H, Al-Abdely HM, El-Saed A, et al.Заметки с мест: внутрибольничная вспышка ближневосточного респираторного синдрома в крупной больнице третичного уровня — Эр-Рияд, Саудовская Аравия, 2015 г. MMWR. Еженедельный отчет о заболеваемости и смертности. 2016. Т. 65. С. 163–164.

    [11] Balkhy HH, Alenazi TH, Alshamrani MM, Baffoe-Bonnie H, Arabi Y, Hijazi R, et al. Описание госпитальной вспышки ближневосточного респираторного синдрома в крупной больнице третичного уровня в Саудовской Аравии. Инфекционный контроль и больничная эпидемиология. 2016. Т. 37. С. 1147–1155.

    [12] Ассири А.М., Биггс Х.М., Абеди Г.Р., Лу Х., Бин Саид А., Абдалла О. и др.Увеличение числа случаев ближневосточного респираторного синдрома и коронавируса в Саудовской Аравии связано со вспышкой в ​​больнице с продолжающейся циркуляцией рекомбинантного вируса, 1 июля — 31 августа 2015 г. Открытый форум по инфекционным заболеваниям. 2016; 3: ofw165.

    [13] Назер РИ. Вспышка ближневосточного респираторного синдрома-коронавируса вызывает высокую смертность после операций на сердце. Анналы торакальной хирургии. 2017; 104: e127–e129.

    [14] Ассири А., Абеди Г.Р., Бин Саид А.А., Абдалла М.А., аль-Масри М., Чоудхри А.Дж. и соавт.Многоцентровая вспышка ближневосточного респираторного синдрома в Таифе, Саудовская Аравия. Возникающие инфекционные заболевания. 2016. Т. 22. С. 32–40.

    [15] Hunter JC, Nguyen D, Aden B, Al Bandar Z, Al Dhaheri W, Abu Elkheir K, et al. Передача коронавирусных инфекций ближневосточного респираторного синдрома в медицинских учреждениях, Абу-Даби. Возникающие инфекционные заболевания. 2016. Т. 22. С. 647–656.

    [16] Кошемез С., Ван Керхов М.Д., Райли С., Доннелли К.А., Фрейзер С., Фергюсон Н.М. Сценарии передачи коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) и как их отличить.Евронаблюдение. 2013; 18: 20503.

    [17] Cauchemez S, Fraser C, Van Kerkhove MD, Donnelly CA, Riley S, Rambaut A, et al. Коронавирус ближневосточного респираторного синдрома: количественная оценка масштабов эпидемии, погрешности наблюдения и трансмиссивность. Ланцет. Инфекционные заболевания. 2014. Т. 14. С. 50–56.

    [18] Al-Abdallat MM, Payne DC, Alqasrawi S, Rha B, Tohme RA, Abedi GR, et al. Внутрибольничная вспышка коронавируса ближневосточного респираторного синдрома: серологическое, эпидемиологическое и клиническое описание.Клинические инфекционные заболевания. 2014. Т. 59. С. 1225–1233.

    [19] Chowell G, Abdirizak F, Lee S, Lee J, Jung E, Nishiura H, et al. Характеристики передачи MERS и SARS в медицинских учреждениях: сравнительное исследование. БМК Медицина. 2015; 13: 210.

    [20] Барри М., Фан М.В., Аккила Л., Аль-Маджед Ф., Алхетил А., Сомили А. и др. Внутрибольничная вспышка коронавируса ближневосточного респираторного синдрома: филогенетический, эпидемиологический, клинический и инфекционный анализ. Медицина путешествий и инфекционные заболевания.2020; 37: 101807.

    [21] Hijawi B, Abdallat M, Sayydeh A, Alqasrawi S, Haddadin A, Jaarour N, et al. Новые коронавирусные инфекции в Иордании, апрель 2012 г.: эпидемиологические данные ретроспективного расследования. Журнал здравоохранения Восточного Средиземноморья. 2013. Т. 19: С12–С18.

    [22] Аль-Тауфик Дж.А., Мемиш З.А. Факторы передачи БВРС-КоВ: что мы знаем? Экспертный обзор респираторной медицины. 2016. Т. 10. С. 331–338.

    [23] Обохо И.К., Томчик С.М., Аль-Асмари А.М., Банджар А.А., Аль-Мугти Х., Алораини М.С. и соавт.Вспышка БВРС-КоВ в Джидде в 2014 г. – связь с медицинскими учреждениями. Медицинский журнал Новой Англии. 2015. 372: 846–854.

    [24] Альраддади Б., Баварет Н., Омар Х., Алсалми Х., Альшукаири А., Кушмак И. и др. Характеристики пациентов, инфицированных коронавирусной инфекцией ближневосточного респираторного синдрома в больнице третичного уровня. Анналы торакальной медицины. 2016. Т. 11. С. 128–131.

    [25] Fagbo SF, Skakni L, Chu DKW, Garbati MA, Joseph M, Peiris M, et al. Молекулярная эпидемиология госпитальной вспышки ближневосточного респираторного синдрома, Эр-Рияд, Саудовская Аравия, 2014 г.Возникающие инфекционные заболевания. 2015, 21: 1981–1988.

    [26] Алмехлафи Г.А., Альбаррак М.М., Мандура Ю., Хассан С., Алван А., Абудайя А. и др. Представление и исход ближневосточного респираторного синдрома у пациентов отделения интенсивной терапии Саудовской Аравии. Критическая помощь. 2016; 20: 123.

    [27] Саад М., Омрани А.С., Байг К., Бахлул А., Эльзейн Ф., Матин М.А. и соавт. Клинические аспекты и исходы у 70 пациентов с коронавирусной инфекцией ближневосточного респираторного синдрома: опыт работы одного центра в Саудовской Аравии.Международный журнал инфекционных заболеваний. 2014. Т. 29. С. 301–306.

    [28] Ассири А., Аль-Тауфик Дж.А., Аль-Рабиа А.А., Аль-Рабиа Ф.А., Аль-Хаджар С., Аль-Баррак А. и др. Эпидемиологические, демографические и клинические характеристики 47 случаев коронавирусной болезни ближневосточного респираторного синдрома в Саудовской Аравии: описательное исследование. Ланцет. Инфекционные заболевания. 2013. Т. 13. С. 752–761.

    [29] Аль-Тауфик Дж.А., Ассири А., Мемиш З.А. Ближневосточный респираторный синдром, новая коронавирусная инфекция MERS-CoV.Эпидемиология и обновление результатов. Саудовский медицинский журнал. 2013. Т. 34. С. 991–994.

    [30] Янсен А., Чью М., Конингс Ф., Ли С., Айлан Л. Секс имеет значение — предварительный анализ ближневосточного респираторного синдрома в Республике Корея, 2015 г. Журнал наблюдения и реагирования в западной части Тихого океана. 2015. Т. 6. С. 68–71.

    [31] Али М.А. Гендерная динамика и социокультурные детерминанты коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) в Саудовской Аравии. Медицинский журнал Университета Торонто. 2017. Т. 94. С. 32–37.

    [32] Аль-Тауфик Дж. А., Perl TM. Коронавирус ближневосточного респираторного синдрома в медицинских учреждениях. Текущее мнение об инфекционных заболеваниях. 2015. Т. 28. С. 392–396.

    [33] Аль-Тауфик Дж. А., Готре П. Бессимптомная коронавирусная инфекция ближневосточного респираторного синдрома (БВРС-КоВ): Масштабы и последствия для инфекционного контроля: систематический обзор. Медицина путешествий и инфекционные заболевания. 2019. Т. 27. С. 27–32.

    [34] Аль-Тауфик Дж.А. Бессимптомная коронавирусная инфекция: MERS-CoV и SARS-CoV-2 (COVID-19).Медицина путешествий и инфекционные заболевания. 2020; 35: 101608.

    [35] Аль-Тауфик Дж.А., Аувартер П.Г. Инфекции, связанные с оказанием медицинской помощи: отличительная черта коронавируса ближневосточного респираторного синдрома с обзором литературы. Журнал госпитальной инфекции. 2019. С. 101: 20–29.

    [36] Аль-Гетами М., Корман В.М., Хуссейн Р., Аль-Тауфик Дж.А., Дростен С., Мемиш З.А. Случай длительного выделения и субклинической инфекции коронавирусом ближневосточного респираторного синдрома у медицинского работника.Клинические инфекционные заболевания. 2015. Т. 60. С. 973–974.

    [37] Al-Abdely HM, Midgley CM, Alkhamis AM, Abedi GR, Tamin A, Binder AM, et al. Инфекционный MERS-CoV, выделенный от легкобольного пациента, Саудовская Аравия. Открытый форум по инфекционным заболеваниям. 2018; 5: ofy111.

    [38] Корман В.М., Альбаррак А.М., Омрани А.С., Альбаррак М.М., Фарах М.Е., Алмасри М. и соавт. Выделение вируса и реакция антител у 37 пациентов с коронавирусной инфекцией Ближневосточного респираторного синдрома. Клинические инфекционные заболевания.2016. Т. 62. С. 477–483.

    [39] Мемиш З.А., Ассири А.М., Аль-Тауфик Дж.А. Выделение вируса коронавируса ближневосточного респираторного синдрома (БВРС-КоВ) в дыхательных путях: наблюдательный анализ с последствиями инфекционного контроля. Международный журнал инфекционных заболеваний. 2014. Т. 29. С. 307–308.

    [40] Аль-Тауфик Дж.А., Хинеди К., Гандур Дж., Хайралла Х., Муслех С., Уджайли А. и др. Коронавирус ближневосточного респираторного синдрома: исследование госпитализированных пациентов методом случай-контроль. Клинические инфекционные заболевания.2014. Т. 59. С. 160–165.

    [41] Араби Ю.М., Арифи А.А., Балхи Х.Х., Наджм Х., Алдавуд А.С., Габаши А. и др. Клиническое течение и исходы у больных в критическом состоянии с коронавирусной инфекцией ближневосточного респираторного синдрома. Анналы внутренней медицины. 2014. 160: 389–397.

    [42] Шалхуб С., Фарахат Ф., Аль-Джиффри А., Симхаири Р., Шамма О., Сиддики Н. и др. IFN-α2a или IFN-β1a в комбинации с рибавирином для лечения коронавирусной пневмонии с ближневосточным респираторным синдромом: ретроспективное исследование.Журнал антимикробной химиотерапии. 2015, 70: 2129–2132.

    [43] Халим А.А., Альсайед Б., Эмбарак С., Ясин Т., Даббоус С. Клинические характеристики и результаты госпитализации пациентов, инфицированных коронавирусом MERS, в ОИТ. Египетский журнал болезней органов грудной клетки и туберкулеза. 2016. Т. 65. С. 81–87.

    [44] Мацуяма Р., Нисиура Х., Куцуна С., Хаякава К., Омагари Н. Клинические детерминанты тяжести ближневосточного респираторного синдрома (БВРС): систематический обзор и метаанализ. Общественное здравоохранение BMC.2016; 16: 1203.

    [45] Аль-Хамид Ф., Вахла А.С., Сиддики С., Габаши А., Аль-Шомрани М., Аль-Такафи А. и др. Характеристики и исходы пациентов с коронавирусом с ближневосточным респираторным синдромом, госпитализированных в отделение интенсивной терапии в Джидде, Саудовская Аравия. Журнал интенсивной терапии. 2016. Т. 31. С. 344–348.

    [46] Рахман А., Саркар А. Факторы риска смертельного ближневосточного респираторного синдрома Коронавирусные инфекции в Саудовской Аравии: анализ линейного списка ВОЗ, 2013–2018 гг. Американский журнал общественного здравоохранения.2019; 109: 1288–1293.

    [47] Тирупати Р., Мурадова В., Шекхар Р., Салим С.А., Аль-Тауфик Дж.А., Палабиндала В. Неравенство в связи с COVID-19 среди расовых и этнических меньшинств в США: перекрестный анализ. Медицина путешествий и инфекционные заболевания. 2020; 38: 101904.

    [48] Аль-Тауфик Дж. А., Леонарди Р., Фасоли Г., Ригамонти Д. Показатели распространенности и смертности от COVID-19: каковы причины больших различий во всем мире? Медицина путешествий и инфекционные заболевания. 2020; 35: 101711.

    [49] Ригамонти Д.Смертность от коронавирусных заболеваний: понимание региональных различий. Для публикации в Erciyes Medical Journal. 2021. (Препринт)

    Отображение подробностей содержания 07-10 mers в сорго, цельное зерно

    Отображение подробностей содержания 07-10 mers в сорго, цельное зерно — Phenol-Explorer

    Расчетные средние значения содержания

    Единицы Средний Мин. Максимум Стандартное отклонение
    мг/100 г сырой массы 233.55 150.00 325,00 86,56
    моль/100 г 0,00 0,00 0,00 0,00

    Значения, рассчитанные путем агрегирования данных из 4 разные образцы от 2 уникальный публикации.

    Средние значения содержания агликона

    Агликон Единицы Средний Мин. Максимум Стандартное отклонение

    Значения исходного содержания, используемые для создания средств

    Гу, Л., Келм М.А., Хаммерстон Дж.Ф., Бичер Г.Р., Холлман П.Ч., Хейтовиц Д., Гебхардт С., Прайор Р.Л. (2004) Концентрация проантоцианидинов в обычных продуктах питания и оценки нормального потребления. Journal of Nutrition 134 :613-617 PubMed (14988456)
    Значение исходного содержимого Оригинальное описание продукта питания Коммерческое происхождение Количество проанализированных проб
    289.20 мг/100 г сырой массы тела Сорго сумах цельнозерновой нет 1
    150,00 мг/100 г сырой массы тела Сорго Цельное зерно с высоким содержанием танинов нет 1
    Awika J.M., Dykes L., Gu L., Rooney L.W., Prior R.L. (2003)Обработка сорго (Sorghum bicolor) и продуктов из сорго изменяет распределение и содержание процианидиновых олигомеров и полимеров. Журнал сельскохозяйственной и пищевой химии 51 :5516-5521 PubMed (12926907)
    Значение исходного содержимого Оригинальное описание продукта питания Коммерческое происхождение Количество проанализированных проб
    170,00 мг/100 г сырой массы Коричневое зерно сорго нет 1
    325.

    alexxlab

    E-mail : alexxlab@gmail.com

    Submit A Comment

    Must be fill required * marked fields.

    :*
    :*